CU116723 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGAGGTCAAGTTCTACGTCCACCTCTCACCCTCTCGTCTCGGCCTATCATCTCACGCCGTCGTCGCTGTTCAATCGTCTCTCCTTCTCAGTCTCCGGCGGTCATCTCCGATCGTCTCCACTTCTCAGAAGTCTCCGATTGTCGCTCGCGCTTGGCTCTCCCTCACCATTGCGTTGTTGTGTTGCCGCTGGCTACGATACCTTGTTGTGTACAACTCA
BLAST of CU116723 vs. TrEMBL
Match: A0A0A0K8Z3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G237810 PE=4 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 4.0e-11 Identity = 40/65 (61.54%), Postives = 40/65 (61.54%), Query Frame = 3
BLAST of CU116723 vs. NCBI nr
Match: gi|700189033|gb|KGN44266.1| (hypothetical protein Csa_7G237810 [Cucumis sativus]) HSP 1 Score: 74.7 bits (182), Expect = 7.5e-11 Identity = 40/65 (61.54%), Postives = 40/65 (61.54%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|