CU116660 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTCTTTTTTGAGGCTGATTCTAATTTAATATATAATTATGTAAGATTAATCTAAGTTGTTTTGGTTGAAAGTCAGTGAAAAACAAGCCTTTGGAATTTGGTCGCCGGTAACGTATCCGATTCCTCACACAAAGACAGAGCCCTCTTCTTGTTAACAATCCCACAATGAGTAGCCTCAGAATGAACAGGTACCAGCGGCGGCGGTGGCGGAGGATGTGGAATTGCAACCGGCGGCAAGTGGAAAAGATTCAAGCGGCGGCGGCGGATGTCTCCACTGAGGAAGCGGTCCAG
BLAST of CU116660 vs. TrEMBL
Match: A0A0A0LS86_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G097650 PE=4 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 5.3e-11 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = -1
BLAST of CU116660 vs. NCBI nr
Match: gi|449459090|ref|XP_004147279.1| (PREDICTED: formin-3 [Cucumis sativus]) HSP 1 Score: 76.3 bits (186), Expect = 3.4e-11 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = -1
BLAST of CU116660 vs. NCBI nr
Match: gi|659072065|ref|XP_008463249.1| (PREDICTED: formin-3 [Cucumis melo]) HSP 1 Score: 72.0 bits (175), Expect = 6.4e-10 Identity = 33/35 (94.29%), Postives = 35/35 (100.00%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|