CU116498 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGAGGTGAATTCCTTATGTGCTACTGTTTGCAGCGCCATCAGCATATAAGGATCAAATTGAAGAGGAGAGAGTGAAGAGATGGTTCCCAGATTTCTAATTCAGCGGCTAACACCATATTTGGGAGCACATATCCGAAAGAACCAAAGGCTTCTTAGCTCTTCTGTTTCAGCCTATCAAGAAGCCTCTTCTTCGTTGATAACTCCATCTGCGGGCATTGATACAATT
BLAST of CU116498 vs. TrEMBL
Match: A0A0A0LSN2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G108280 PE=4 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 2.3e-09 Identity = 36/49 (73.47%), Postives = 36/49 (73.47%), Query Frame = 1
BLAST of CU116498 vs. NCBI nr
Match: gi|778659089|ref|XP_011653808.1| (PREDICTED: iron-sulfur assembly protein IscA-like 2, mitochondrial isoform X2 [Cucumis sativus]) HSP 1 Score: 70.5 bits (171), Expect = 1.5e-09 Identity = 36/49 (73.47%), Postives = 36/49 (73.47%), Query Frame = 1
BLAST of CU116498 vs. NCBI nr
Match: gi|700209707|gb|KGN64803.1| (hypothetical protein Csa_1G108280 [Cucumis sativus]) HSP 1 Score: 70.5 bits (171), Expect = 1.5e-09 Identity = 36/49 (73.47%), Postives = 36/49 (73.47%), Query Frame = 1
BLAST of CU116498 vs. NCBI nr
Match: gi|449459108|ref|XP_004147288.1| (PREDICTED: iron-sulfur assembly protein IscA-like 2, mitochondrial isoform X1 [Cucumis sativus]) HSP 1 Score: 70.5 bits (171), Expect = 1.5e-09 Identity = 36/49 (73.47%), Postives = 36/49 (73.47%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|