CU116372 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTCTCTTCTTCTTTGTCCTGATCTAACCATTTCAACTCCATCGCGGGAATCTCTGAGCTCTCTCTCTCTCTCTCTCTATCTATCTCTTTCTTCTAGACATAGCCACCGGAAAACAATGGCGTCGTCGACGGCTAAGATTACGTTTCGTGTTATCATGGTGGTGATCCTCCTCCTCGTCTTGTTCTATGTCGGTCGTCCTCTGTACTGGAAGATTTCCGCTACTGTACATGATATTCGTCAGAACAAACAGACCGTCAAAGAAGGCCTCTCTCAGATTGTTCTGGAAGCTCAGAAATCGGTGGGATGGTACCATGATGAGTCGGACTCGGGCGTTCATGATGGAAATGGTGGAAAGAAAGCCGGATCGGGTGCTATTCGGAGGCTGCTTCATCAGTT
BLAST of CU116372 vs. TrEMBL
Match: A0A0A0KBE9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G067370 PE=4 SV=1) HSP 1 Score: 162.9 bits (411), Expect = 2.6e-37 Identity = 81/93 (87.10%), Postives = 81/93 (87.10%), Query Frame = 3
BLAST of CU116372 vs. TrEMBL
Match: W9S2S8_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_011283 PE=4 SV=1) HSP 1 Score: 129.8 bits (325), Expect = 2.4e-27 Identity = 64/90 (71.11%), Postives = 69/90 (76.67%), Query Frame = 3
BLAST of CU116372 vs. TrEMBL
Match: M5XMT6_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa013919mg PE=4 SV=1) HSP 1 Score: 119.8 bits (299), Expect = 2.5e-24 Identity = 61/94 (64.89%), Postives = 68/94 (72.34%), Query Frame = 3
BLAST of CU116372 vs. TrEMBL
Match: A0A0D2UVA1_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_011G183300 PE=4 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 2.1e-23 Identity = 59/91 (64.84%), Postives = 69/91 (75.82%), Query Frame = 3
BLAST of CU116372 vs. TrEMBL
Match: A0A0D2RYN0_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_006G074800 PE=4 SV=1) HSP 1 Score: 116.3 bits (290), Expect = 2.8e-23 Identity = 56/82 (68.29%), Postives = 67/82 (81.71%), Query Frame = 3
BLAST of CU116372 vs. NCBI nr
Match: gi|700190975|gb|KGN46179.1| (hypothetical protein Csa_6G067370 [Cucumis sativus]) HSP 1 Score: 162.9 bits (411), Expect = 3.7e-37 Identity = 81/93 (87.10%), Postives = 81/93 (87.10%), Query Frame = 3
BLAST of CU116372 vs. NCBI nr
Match: gi|778710941|ref|XP_011656651.1| (PREDICTED: uncharacterized protein LOC101217077 isoform X1 [Cucumis sativus]) HSP 1 Score: 162.9 bits (411), Expect = 3.7e-37 Identity = 81/93 (87.10%), Postives = 81/93 (87.10%), Query Frame = 3
BLAST of CU116372 vs. NCBI nr
Match: gi|778710944|ref|XP_011656652.1| (PREDICTED: uncharacterized protein LOC101217077 isoform X2 [Cucumis sativus]) HSP 1 Score: 162.9 bits (411), Expect = 3.7e-37 Identity = 81/93 (87.10%), Postives = 81/93 (87.10%), Query Frame = 3
BLAST of CU116372 vs. NCBI nr
Match: gi|778710947|ref|XP_011656653.1| (PREDICTED: uncharacterized protein LOC101217077 isoform X3 [Cucumis sativus]) HSP 1 Score: 162.9 bits (411), Expect = 3.7e-37 Identity = 81/93 (87.10%), Postives = 81/93 (87.10%), Query Frame = 3
BLAST of CU116372 vs. NCBI nr
Match: gi|659117277|ref|XP_008458515.1| (PREDICTED: uncharacterized protein LOC103497900 isoform X2 [Cucumis melo]) HSP 1 Score: 156.4 bits (394), Expect = 3.5e-35 Identity = 79/93 (84.95%), Postives = 79/93 (84.95%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|