CU115349 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACTATACGGCAGCAAGTTTAATTTTTCTACTAGTCCTTTCTTTGTTACATGGGATAGAATACTTGGTACCTATATGCCTTACTTCCTTTGGAGAAGAGAGCAAGCGGCGGCTTTGAAGCACGACCAAAGATTGAATAAATACCGTAAGCAGCAATCAGTTGCTTATATTATATTATTTGTATCCCACAACTATATGATTTGTATATTACTCCTATTGTTGCCATTTTTATACTTTTTCCCCCATTTCCCCTCTCTTCCCTAACATAGATTTGAAACATGAGTTCAGATGAGCTAGGTTGTGTTTTGATATATATATTTTTTAAAAAAATTTATTAATTTTTTAGACGAAAAAACAGAAAC
BLAST of CU115349 vs. Swiss-Prot
Match: SBH1_ARATH (Sphinganine C4-monooxygenase 1 OS=Arabidopsis thaliana GN=SBH1 PE=1 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 8.1e-07 Identity = 25/33 (75.76%), Postives = 26/33 (78.79%), Query Frame = 2
BLAST of CU115349 vs. Swiss-Prot
Match: SBH2_ARATH (Sphinganine C4-monooxygenase 2 OS=Arabidopsis thaliana GN=SBH2 PE=1 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 6.9e-06 Identity = 23/32 (71.88%), Postives = 25/32 (78.12%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|