CU115248 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CACCACAGCCGTCTTTCCTATCAATAGACTTAGGTGAAATTCGAGGCTTTGAGTCGGAATCGAAAAATGAAAAATTGGGCTTGGCGCAGGGAGGGCAGAGATAAGAGGAGGAGGTAGTGGAGGACAGAAGCTGAGGGTCGGGGCAAGCCGGATTGACAACGCAATGAGAATGCGTAATAGAAGAACATTTAGAACAAGTGAAACGATTGGAGGGATGAGGAGACACAGAAAGATCATAGAACTGGGAAGCAAAGGAAGGG
BLAST of CU115248 vs. TrEMBL
Match: A0A0A0LYS3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G560710 PE=4 SV=1) HSP 1 Score: 150.6 bits (379), Expect = 8.7e-34 Identity = 68/77 (88.31%), Postives = 68/77 (88.31%), Query Frame = -2
BLAST of CU115248 vs. TrEMBL
Match: A0A067JHK0_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_23170 PE=4 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.4e-07 Identity = 33/76 (43.42%), Postives = 43/76 (56.58%), Query Frame = -2
BLAST of CU115248 vs. TrEMBL
Match: B9RFQ8_RICCO (DNA binding protein, putative OS=Ricinus communis GN=RCOM_1436640 PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 1.2e-06 Identity = 33/75 (44.00%), Postives = 45/75 (60.00%), Query Frame = -2
BLAST of CU115248 vs. NCBI nr
Match: gi|778662161|ref|XP_011659447.1| (PREDICTED: uncharacterized protein LOC105436183 [Cucumis sativus]) HSP 1 Score: 147.9 bits (372), Expect = 8.1e-33 Identity = 68/77 (88.31%), Postives = 68/77 (88.31%), Query Frame = -2
BLAST of CU115248 vs. NCBI nr
Match: gi|659099270|ref|XP_008450515.1| (PREDICTED: uncharacterized protein LOC103492096 [Cucumis melo]) HSP 1 Score: 145.6 bits (366), Expect = 4.0e-32 Identity = 67/77 (87.01%), Postives = 67/77 (87.01%), Query Frame = -2
BLAST of CU115248 vs. NCBI nr
Match: gi|1009116458|ref|XP_015874783.1| (PREDICTED: uncharacterized protein LOC107411671 [Ziziphus jujuba]) HSP 1 Score: 71.6 bits (174), Expect = 7.4e-10 Identity = 37/79 (46.84%), Postives = 46/79 (58.23%), Query Frame = -2
BLAST of CU115248 vs. NCBI nr
Match: gi|802755152|ref|XP_012088829.1| (PREDICTED: uncharacterized protein LOC105647377 [Jatropha curcas]) HSP 1 Score: 61.6 bits (148), Expect = 7.7e-07 Identity = 33/76 (43.42%), Postives = 43/76 (56.58%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|