CU114810 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTGTGATAATCTCATGGATTCACGGGATAAACCAGAATATTTTTGGTTCATTTTCCATTCTTCATAAAGTGTTGGAACTACACCTCCAAGCACCGATAACCCTTTTGAACCTAAACATGCTATTCCACTATGCACTGGAGCTTTATTTTCCAAACGAATCTTGGTGCCAGGAGGAATGTCATCAGGAATAGATGGTATATGAGAGTACTCTATAGCAGTAATCTCAGAGTGTCCATCA
BLAST of CU114810 vs. TrEMBL
Match: A0A067K7X7_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_13256 PE=4 SV=1) HSP 1 Score: 92.4 bits (228), Expect = 2.6e-16 Identity = 46/79 (58.23%), Postives = 50/79 (63.29%), Query Frame = -2
BLAST of CU114810 vs. TrEMBL
Match: A0A072V9B3_MEDTR (Tudor domain protein OS=Medicago truncatula GN=MTR_2g050180 PE=4 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 7.5e-16 Identity = 44/76 (57.89%), Postives = 49/76 (64.47%), Query Frame = -2
BLAST of CU114810 vs. TrEMBL
Match: A0A061GP19_THECC (Domain of Uncharacterized protein function, putative isoform 1 OS=Theobroma cacao GN=TCM_037953 PE=4 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 6.4e-15 Identity = 44/79 (55.70%), Postives = 49/79 (62.03%), Query Frame = -2
BLAST of CU114810 vs. TrEMBL
Match: A0A061GNC6_THECC (Domain of Uncharacterized protein function, putative isoform 2 OS=Theobroma cacao GN=TCM_037953 PE=4 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 6.4e-15 Identity = 44/79 (55.70%), Postives = 49/79 (62.03%), Query Frame = -2
BLAST of CU114810 vs. TrEMBL
Match: A0A151RJH7_CAJCA (Tudor domain-containing protein 3 OS=Cajanus cajan GN=KK1_035871 PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 1.1e-14 Identity = 43/76 (56.58%), Postives = 48/76 (63.16%), Query Frame = -2
BLAST of CU114810 vs. NCBI nr
Match: gi|778660601|ref|XP_004149862.2| (PREDICTED: tudor domain-containing protein 3 [Cucumis sativus]) HSP 1 Score: 110.5 bits (275), Expect = 1.3e-21 Identity = 56/79 (70.89%), Postives = 56/79 (70.89%), Query Frame = -2
BLAST of CU114810 vs. NCBI nr
Match: gi|659126760|ref|XP_008463350.1| (PREDICTED: tudor domain-containing protein 3 isoform X2 [Cucumis melo]) HSP 1 Score: 105.9 bits (263), Expect = 3.3e-20 Identity = 53/79 (67.09%), Postives = 55/79 (69.62%), Query Frame = -2
BLAST of CU114810 vs. NCBI nr
Match: gi|643722581|gb|KDP32331.1| (hypothetical protein JCGZ_13256 [Jatropha curcas]) HSP 1 Score: 92.8 bits (229), Expect = 2.8e-16 Identity = 46/79 (58.23%), Postives = 50/79 (63.29%), Query Frame = -2
BLAST of CU114810 vs. NCBI nr
Match: gi|802640663|ref|XP_012078933.1| (PREDICTED: uncharacterized protein LOC105639462 [Jatropha curcas]) HSP 1 Score: 92.8 bits (229), Expect = 2.8e-16 Identity = 46/79 (58.23%), Postives = 50/79 (63.29%), Query Frame = -2
BLAST of CU114810 vs. NCBI nr
Match: gi|502149673|ref|XP_004507622.1| (PREDICTED: tudor domain-containing protein 3 isoform X1 [Cicer arietinum]) HSP 1 Score: 91.7 bits (226), Expect = 6.3e-16 Identity = 44/76 (57.89%), Postives = 49/76 (64.47%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|