CU113247 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGTTCCAGAAAATGTGGTAGTCTCCAAACCATCAGAAACTGACAGACTTTCAGTTTTCTCTGCTAACTTGTCAACAATCTCATCAGTCCGATCCTGAAGTACAACCTTCTTCTTCTTCTTCTTCTTAGTTGGATCGAGGGCAATATCTGCCACCTGATCGTTCGCATCATTCTGAACTTCGTCCTCCATC
BLAST of CU113247 vs. TrEMBL
Match: A0A0A0LT22_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G028050 PE=4 SV=1) HSP 1 Score: 104.4 bits (259), Expect = 5.3e-20 Identity = 54/62 (87.10%), Postives = 54/62 (87.10%), Query Frame = -2
BLAST of CU113247 vs. TrEMBL
Match: A0A0A0LY41_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G145930 PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 8.7e-15 Identity = 48/63 (76.19%), Postives = 48/63 (76.19%), Query Frame = -2
BLAST of CU113247 vs. TrEMBL
Match: F6GU78_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_06s0004g08180 PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 2.1e-08 Identity = 37/63 (58.73%), Postives = 45/63 (71.43%), Query Frame = -2
BLAST of CU113247 vs. TrEMBL
Match: I3SDH8_LOTJA (Uncharacterized protein OS=Lotus japonicus PE=2 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 1.1e-06 Identity = 34/63 (53.97%), Postives = 43/63 (68.25%), Query Frame = -2
BLAST of CU113247 vs. NCBI nr
Match: gi|700208831|gb|KGN63927.1| (hypothetical protein Csa_1G028050 [Cucumis sativus]) HSP 1 Score: 100.5 bits (249), Expect = 1.1e-18 Identity = 54/62 (87.10%), Postives = 54/62 (87.10%), Query Frame = -2
BLAST of CU113247 vs. NCBI nr
Match: gi|778656633|ref|XP_011649426.1| (PREDICTED: eukaryotic translation initiation factor 2 subunit beta-like [Cucumis sativus]) HSP 1 Score: 100.5 bits (249), Expect = 1.1e-18 Identity = 54/62 (87.10%), Postives = 54/62 (87.10%), Query Frame = -2
BLAST of CU113247 vs. NCBI nr
Match: gi|659071819|ref|XP_008462075.1| (PREDICTED: eukaryotic translation initiation factor 2 subunit beta [Cucumis melo]) HSP 1 Score: 87.0 bits (214), Expect = 1.2e-14 Identity = 50/63 (79.37%), Postives = 50/63 (79.37%), Query Frame = -2
BLAST of CU113247 vs. NCBI nr
Match: gi|778659350|ref|XP_004139463.2| (PREDICTED: eukaryotic translation initiation factor 2 subunit beta [Cucumis sativus]) HSP 1 Score: 83.2 bits (204), Expect = 1.8e-13 Identity = 48/63 (76.19%), Postives = 48/63 (76.19%), Query Frame = -2
BLAST of CU113247 vs. NCBI nr
Match: gi|1009116240|ref|XP_015874665.1| (PREDICTED: eukaryotic translation initiation factor 2 subunit beta [Ziziphus jujuba]) HSP 1 Score: 63.2 bits (152), Expect = 1.9e-07 Identity = 38/63 (60.32%), Postives = 45/63 (71.43%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|