CU112751 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGCGTATTCGAGAAAGGCGTTTCCATTTTCCAGACTTGTTTTAGAGCGAAAAACAGAGGCTCGTCACTCTGGGACTTCACCATTCTTCATTAAGAGATCTCCCAAAAAGCTGGTCGAGGCTTCTCATGAAAGCCGTGGGAAGCTTTCTGTCTCCTGAACATCTGAATGAGAAGTGCATTGTAGTTAGTATATGAAGCTGAACTTGGTCTTTTCCATCTCTGTGTTTCAGTAGAAGGCAGAAAAAG
BLAST of CU112751 vs. TrEMBL
Match: A0A0A0LRF2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G050120 PE=4 SV=1) HSP 1 Score: 102.4 bits (254), Expect = 2.7e-19 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = 1
BLAST of CU112751 vs. NCBI nr
Match: gi|700209277|gb|KGN64373.1| (hypothetical protein Csa_1G050120 [Cucumis sativus]) HSP 1 Score: 102.1 bits (253), Expect = 5.0e-19 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|