CU112353 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTAATCACAAACATATTTTAAATATAATTATATGATGAAAGAGTGATAACACTCTAAGCTAAAAACAAATTACAATAATTTAATTATGGAAACAAAAATTAAAAAACTAAGAAAAAACAAATACAACTTTCTACACATTGGAATTAGGTCCATTGGGATGAATAGTGACAGTTTGACGCTCGGTTTCGAAGACACGATTTTTATAAATCCTATCGATGTAATCTTTGGCCTTTCTATCGATCCCCG
BLAST of CU112353 vs. TrEMBL
Match: A0A0A0KBW6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G016910 PE=4 SV=1) HSP 1 Score: 106.7 bits (265), Expect = 1.4e-20 Identity = 52/53 (98.11%), Postives = 52/53 (98.11%), Query Frame = 2
BLAST of CU112353 vs. TrEMBL
Match: A0A0A0K8W0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G016905 PE=4 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 2.2e-10 Identity = 33/33 (100.00%), Postives = 33/33 (100.00%), Query Frame = -3
BLAST of CU112353 vs. TrEMBL
Match: A0A0A0KBW1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G014870 PE=4 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 1.0e-07 Identity = 29/32 (90.62%), Postives = 31/32 (96.88%), Query Frame = -3
BLAST of CU112353 vs. TrEMBL
Match: A0A0A0KAK6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G014890 PE=4 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 1.0e-07 Identity = 29/32 (90.62%), Postives = 31/32 (96.88%), Query Frame = -3
BLAST of CU112353 vs. TrEMBL
Match: A0A0A0K7Y2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G014900 PE=4 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 1.0e-07 Identity = 29/32 (90.62%), Postives = 31/32 (96.88%), Query Frame = -3
BLAST of CU112353 vs. NCBI nr
Match: gi|700190668|gb|KGN45872.1| (hypothetical protein Csa_6G016910 [Cucumis sativus]) HSP 1 Score: 105.5 bits (262), Expect = 4.4e-20 Identity = 52/53 (98.11%), Postives = 52/53 (98.11%), Query Frame = 2
BLAST of CU112353 vs. NCBI nr
Match: gi|700190669|gb|KGN45873.1| (hypothetical protein Csa_6G016905 [Cucumis sativus]) HSP 1 Score: 72.8 bits (177), Expect = 3.1e-10 Identity = 33/33 (100.00%), Postives = 33/33 (100.00%), Query Frame = -3
BLAST of CU112353 vs. NCBI nr
Match: gi|700190665|gb|KGN45869.1| (hypothetical protein Csa_6G014890 [Cucumis sativus]) HSP 1 Score: 63.9 bits (154), Expect = 1.5e-07 Identity = 29/32 (90.62%), Postives = 31/32 (96.88%), Query Frame = -3
BLAST of CU112353 vs. NCBI nr
Match: gi|700190663|gb|KGN45867.1| (hypothetical protein Csa_6G014870 [Cucumis sativus]) HSP 1 Score: 63.9 bits (154), Expect = 1.5e-07 Identity = 29/32 (90.62%), Postives = 31/32 (96.88%), Query Frame = -3
BLAST of CU112353 vs. NCBI nr
Match: gi|700190666|gb|KGN45870.1| (hypothetical protein Csa_6G014900 [Cucumis sativus]) HSP 1 Score: 63.9 bits (154), Expect = 1.5e-07 Identity = 29/32 (90.62%), Postives = 31/32 (96.88%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|