CU112054 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGAAGAGAATATGTTTTTTTTAGATTAGAATGGAATCCACTACAAATATGGTTCTCTTTTTTCTCCTTTCCAAGTTTATATATAACAGGTAATCTAAGAGCATACCCATTGTCATAGTGTGGCCTTGTCAGAGCTTTGAATGTCAGATATGATTTACAATGGCTCCGACTCCATTGGGCTGCTCATGCTAAATGCAAACGGCTATGACATTCCGGAGTTTCGGTTTCGTGAGC
BLAST of CU112054 vs. TrEMBL
Match: A0A0A0KZF2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G293140 PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 1.1e-06 Identity = 28/29 (96.55%), Postives = 28/29 (96.55%), Query Frame = 3
BLAST of CU112054 vs. NCBI nr
Match: gi|700199046|gb|KGN54204.1| (hypothetical protein Csa_4G293140 [Cucumis sativus]) HSP 1 Score: 61.6 bits (148), Expect = 7.0e-07 Identity = 28/29 (96.55%), Postives = 28/29 (96.55%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|