CU111118 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCCCGTAGAGAGGAATCGATTACAGATTGCGTGGTCGGAAGTGGAAGGAATGAGGGAAAGATTGATTGAAGTCTTTGAAGGAGTCGAACCAAAGAGCTTTGGCCTTCTGATGAGAGAGACTTTGAAGATGGCGTTTTCGAGCAAAGGGAGTGTCTTGAAATTGCTTATCGCAGTAGTCGCAATAATATTTTCCCAATGGCATCTTCTTCTTCGATTCCTTCAGCCTTCTTCTTCGTCGTTCCAAAGCTTTCTTTAAAGCCTTTCTGTTTCCGATCAATTTCTCCTCCAATCTATCTTATGCTTTTTCCCCCACAATTTCTAAATTCTATTTGTTTTTCTTTATCCCCGGCCG
BLAST of CU111118 vs. Swiss-Prot
Match: C3H3_ORYSJ (Zinc finger CCCH domain-containing protein 3 OS=Oryza sativa subsp. japonica GN=Os01g0252200 PE=2 SV=2) HSP 1 Score: 76.6 bits (187), Expect = 2.0e-13 Identity = 30/43 (69.77%), Postives = 34/43 (79.07%), Query Frame = -1
BLAST of CU111118 vs. Swiss-Prot
Match: ZMAT5_BOVIN (Zinc finger matrin-type protein 5 OS=Bos taurus GN=ZMAT5 PE=2 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 1.1e-08 Identity = 23/40 (57.50%), Postives = 27/40 (67.50%), Query Frame = -1
BLAST of CU111118 vs. Swiss-Prot
Match: ZMAT5_DANRE (Zinc finger matrin-type protein 5 OS=Danio rerio GN=zmat5 PE=2 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 1.1e-08 Identity = 22/40 (55.00%), Postives = 27/40 (67.50%), Query Frame = -1
BLAST of CU111118 vs. Swiss-Prot
Match: ZMAT5_HUMAN (Zinc finger matrin-type protein 5 OS=Homo sapiens GN=ZMAT5 PE=1 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 2.5e-08 Identity = 22/40 (55.00%), Postives = 27/40 (67.50%), Query Frame = -1
BLAST of CU111118 vs. Swiss-Prot
Match: ZMAT5_MOUSE (Zinc finger matrin-type protein 5 OS=Mus musculus GN=Zmat5 PE=2 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 2.5e-08 Identity = 22/40 (55.00%), Postives = 27/40 (67.50%), Query Frame = -1
BLAST of CU111118 vs. TrEMBL
Match: A0A0A0M1B0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G560650 PE=4 SV=1) HSP 1 Score: 132.9 bits (333), Expect = 2.6e-28 Identity = 58/58 (100.00%), Postives = 58/58 (100.00%), Query Frame = -1
BLAST of CU111118 vs. TrEMBL
Match: W9RHS5_9ROSA (Zinc finger CCCH domain-containing protein 3 OS=Morus notabilis GN=L484_001153 PE=4 SV=1) HSP 1 Score: 98.6 bits (244), Expect = 5.4e-18 Identity = 42/53 (79.25%), Postives = 46/53 (86.79%), Query Frame = -1
BLAST of CU111118 vs. TrEMBL
Match: D7UA82_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_14s0060g00610 PE=4 SV=1) HSP 1 Score: 92.0 bits (227), Expect = 5.0e-16 Identity = 39/47 (82.98%), Postives = 43/47 (91.49%), Query Frame = -1
BLAST of CU111118 vs. TrEMBL
Match: V4SWC1_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10012993mg PE=4 SV=1) HSP 1 Score: 92.0 bits (227), Expect = 5.0e-16 Identity = 38/53 (71.70%), Postives = 44/53 (83.02%), Query Frame = -1
BLAST of CU111118 vs. TrEMBL
Match: A0A067E275_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g026840mg PE=4 SV=1) HSP 1 Score: 92.0 bits (227), Expect = 5.0e-16 Identity = 38/53 (71.70%), Postives = 44/53 (83.02%), Query Frame = -1
BLAST of CU111118 vs. NCBI nr
Match: gi|449435572|ref|XP_004135569.1| (PREDICTED: zinc finger CCCH domain-containing protein 3 [Cucumis sativus]) HSP 1 Score: 132.5 bits (332), Expect = 4.8e-28 Identity = 58/58 (100.00%), Postives = 58/58 (100.00%), Query Frame = -1
BLAST of CU111118 vs. NCBI nr
Match: gi|659099282|ref|XP_008450521.1| (PREDICTED: zinc finger CCCH domain-containing protein 3 [Cucumis melo]) HSP 1 Score: 128.3 bits (321), Expect = 9.1e-27 Identity = 56/58 (96.55%), Postives = 57/58 (98.28%), Query Frame = -1
BLAST of CU111118 vs. NCBI nr
Match: gi|703106123|ref|XP_010098420.1| (Zinc finger CCCH domain-containing protein 3 [Morus notabilis]) HSP 1 Score: 97.8 bits (242), Expect = 1.3e-17 Identity = 42/53 (79.25%), Postives = 46/53 (86.79%), Query Frame = -1
BLAST of CU111118 vs. NCBI nr
Match: gi|731415967|ref|XP_010659728.1| (PREDICTED: zinc finger CCCH domain-containing protein 3 isoform X1 [Vitis vinifera]) HSP 1 Score: 91.7 bits (226), Expect = 9.4e-16 Identity = 39/47 (82.98%), Postives = 43/47 (91.49%), Query Frame = -1
BLAST of CU111118 vs. NCBI nr
Match: gi|731415971|ref|XP_010659729.1| (PREDICTED: zinc finger CCCH domain-containing protein 3 isoform X2 [Vitis vinifera]) HSP 1 Score: 91.7 bits (226), Expect = 9.4e-16 Identity = 39/47 (82.98%), Postives = 43/47 (91.49%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|