CU110981 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGAATGGAACTAAAAAGCCGTCGGAAAAGAGCATCGTTTCATCTTCTTCGTCCTCACTCTCCTACAAAGAAATGGCTTCCACTTCCATCCCCCTCCTCAATCTCTCCGCCAAAACCTCCATTAGAGCAGCTCTATTCCCTCACTCCTCCGCCATCAAATCTCGCCACCATTTTTCTCTCCCTTTTCTCCCCTCTAAGTCCCCAAAATTCACCCCCATTCGCATGTCCTACAACCCTACTCCAAGCCACCGACCGCCTCATCTCCGCTGT
BLAST of CU110981 vs. TrEMBL
Match: A0A0A0LXS7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G654890 PE=4 SV=1) HSP 1 Score: 114.4 bits (285), Expect = 7.2e-23 Identity = 56/58 (96.55%), Postives = 57/58 (98.28%), Query Frame = 3
BLAST of CU110981 vs. NCBI nr
Match: gi|449442661|ref|XP_004139099.1| (PREDICTED: protein TIC 20-II, chloroplastic [Cucumis sativus]) HSP 1 Score: 110.9 bits (276), Expect = 1.1e-21 Identity = 56/58 (96.55%), Postives = 57/58 (98.28%), Query Frame = 3
BLAST of CU110981 vs. NCBI nr
Match: gi|659085922|ref|XP_008443678.1| (PREDICTED: protein TIC 20-II, chloroplastic [Cucumis melo]) HSP 1 Score: 99.8 bits (247), Expect = 2.6e-18 Identity = 53/61 (86.89%), Postives = 55/61 (90.16%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|