CU110748 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGTTCCATTCTTGTCCATCTCTTCACTCCACCGCCTGATTCCGCCTCGATCTCCGAGCTCTTTGAAGGTCATCTCCGGACGATGCCCAATTCCGTCACCGCCACTGCCCCTTCGTGTCCATCTCCTCACTCTAGTGCCACCGGAACCTTCTATACTGGAAGACGAAACGTCCTCCGTCCTATTCTGTTCAATTTGTGTCCGTAATCTCCAATTCGCCGCATTCTCTCTTCAACATTTAATCCGCAGCCATCACCTCCTCACCGATATATGAAATTGGTGGCGGATCAGGAACGTGTGCAAAGGGGATAATGGATTACATAATGTTGAATGCACCTACAAGAGTTTACAAGACTATGACTTATACTGGAAATAAGTTCGTCTC
BLAST of CU110748 vs. TrEMBL
Match: A0A0A0LZS9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G615180 PE=4 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 9.1e-11 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 1
BLAST of CU110748 vs. TrEMBL
Match: B9RWI6_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_1019820 PE=4 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 1.0e-09 Identity = 32/34 (94.12%), Postives = 33/34 (97.06%), Query Frame = 1
BLAST of CU110748 vs. TrEMBL
Match: A0A124SBK8_CYNCS (Putative S-adenosyl-L-methionine-dependent methyltransferase MidA OS=Cynara cardunculus var. scolymus GN=Ccrd_007020 PE=4 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 2.9e-09 Identity = 31/34 (91.18%), Postives = 33/34 (97.06%), Query Frame = 1
BLAST of CU110748 vs. TrEMBL
Match: A0A162AII4_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_002262 PE=4 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 2.9e-09 Identity = 31/34 (91.18%), Postives = 32/34 (94.12%), Query Frame = 1
BLAST of CU110748 vs. TrEMBL
Match: A0A067L5I6_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_01131 PE=4 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 3.8e-09 Identity = 31/34 (91.18%), Postives = 32/34 (94.12%), Query Frame = 1
BLAST of CU110748 vs. NCBI nr
Match: gi|778663693|ref|XP_011660138.1| (PREDICTED: uncharacterized protein LOC101214232 [Cucumis sativus]) HSP 1 Score: 74.7 bits (182), Expect = 1.3e-10 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 1
BLAST of CU110748 vs. NCBI nr
Match: gi|659099057|ref|XP_008450410.1| (PREDICTED: uncharacterized protein LOC103492021 [Cucumis melo]) HSP 1 Score: 72.8 bits (177), Expect = 5.0e-10 Identity = 33/34 (97.06%), Postives = 33/34 (97.06%), Query Frame = 1
BLAST of CU110748 vs. NCBI nr
Match: gi|255554130|ref|XP_002518105.1| (PREDICTED: NADH dehydrogenase [ubiquinone]) HSP 1 Score: 71.2 bits (173), Expect = 1.4e-09 Identity = 32/34 (94.12%), Postives = 33/34 (97.06%), Query Frame = 1
BLAST of CU110748 vs. NCBI nr
Match: gi|976903045|gb|KVH90971.1| (putative S-adenosyl-L-methionine-dependent methyltransferase MidA [Cynara cardunculus var. scolymus]) HSP 1 Score: 69.7 bits (169), Expect = 4.2e-09 Identity = 31/34 (91.18%), Postives = 33/34 (97.06%), Query Frame = 1
BLAST of CU110748 vs. NCBI nr
Match: gi|1021051828|gb|KZN09606.1| (hypothetical protein DCAR_002262 [Daucus carota subsp. sativus]) HSP 1 Score: 69.7 bits (169), Expect = 4.2e-09 Identity = 31/34 (91.18%), Postives = 32/34 (94.12%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|