CU110744 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACTAAAAGCCAGCGAAAACAAATATCAATTTCTGTCAAACTCATCATAATTAAGAAGCAGAGTCATAATTGACAATTTCAAACAATAATACCAGCTGAAAGAGAAGTAAAACTTGAAGTTAATCGTATTTTTCTCTCCATGAATACACAAGAAAGAAAACCCATGACAATGCCAATGTAACATCCCCAACAACCTGTCGAGGCCAATCCCGGGCGAGATCCTCAAGCTTCCTCTCGAAATAAACTCTCCATATGGCCAT
BLAST of CU110744 vs. TrEMBL
Match: A0A0A0LAF1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G232440 PE=4 SV=1) HSP 1 Score: 102.1 bits (253), Expect = 3.6e-19 Identity = 46/46 (100.00%), Postives = 46/46 (100.00%), Query Frame = -1
BLAST of CU110744 vs. TrEMBL
Match: A0A0J8E4E3_BETVU (Uncharacterized protein OS=Beta vulgaris subsp. vulgaris GN=BVRB_4g096770 PE=4 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 1.3e-16 Identity = 42/46 (91.30%), Postives = 44/46 (95.65%), Query Frame = -1
BLAST of CU110744 vs. TrEMBL
Match: M0TUF4_MUSAM (Uncharacterized protein OS=Musa acuminata subsp. malaccensis PE=4 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 2.2e-16 Identity = 39/46 (84.78%), Postives = 44/46 (95.65%), Query Frame = -1
BLAST of CU110744 vs. TrEMBL
Match: A0A068V4K3_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00042247001 PE=4 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 2.2e-16 Identity = 40/46 (86.96%), Postives = 43/46 (93.48%), Query Frame = -1
BLAST of CU110744 vs. TrEMBL
Match: M5WHX0_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa013009mg PE=4 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 2.2e-16 Identity = 40/46 (86.96%), Postives = 43/46 (93.48%), Query Frame = -1
BLAST of CU110744 vs. NCBI nr
Match: gi|778680327|ref|XP_011651290.1| (PREDICTED: uncharacterized protein LOC101222658 [Cucumis sativus]) HSP 1 Score: 104.0 bits (258), Expect = 1.3e-19 Identity = 46/46 (100.00%), Postives = 46/46 (100.00%), Query Frame = -1
BLAST of CU110744 vs. NCBI nr
Match: gi|700202489|gb|KGN57622.1| (hypothetical protein Csa_3G232440 [Cucumis sativus]) HSP 1 Score: 104.0 bits (258), Expect = 1.3e-19 Identity = 46/46 (100.00%), Postives = 46/46 (100.00%), Query Frame = -1
BLAST of CU110744 vs. NCBI nr
Match: gi|659112034|ref|XP_008456033.1| (PREDICTED: uncharacterized protein LOC103496084 [Cucumis melo]) HSP 1 Score: 104.0 bits (258), Expect = 1.3e-19 Identity = 46/46 (100.00%), Postives = 46/46 (100.00%), Query Frame = -1
BLAST of CU110744 vs. NCBI nr
Match: gi|645240501|ref|XP_008226634.1| (PREDICTED: uncharacterized protein LOC103326207 [Prunus mume]) HSP 1 Score: 96.7 bits (239), Expect = 2.1e-17 Identity = 41/46 (89.13%), Postives = 43/46 (93.48%), Query Frame = -1
BLAST of CU110744 vs. NCBI nr
Match: gi|720013510|ref|XP_010260202.1| (PREDICTED: uncharacterized protein LOC104599389 [Nelumbo nucifera]) HSP 1 Score: 96.3 bits (238), Expect = 2.8e-17 Identity = 40/46 (86.96%), Postives = 44/46 (95.65%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|