CU110512 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTTTTTTTTACGTTTCAAACTCAAGAAAGAGAGAGATTATCTTTCAAATTTCAAGTATTATCCCTTTTTACAGTGCATATGCTGTGATTCCCGTATCACATTCAAGTGAAGGGCTACCAATAGGGATCAGATTCAAATAAAGCAATGATATCCCCACAGAAAGCATACATTTCAAACAGCAGTAAAGTAAGGACAAAATCTTGCACTTTGATATAATCAAGTATGAAGGCCCACAGCACGTTTGGTATATTCAAGGAGGAATTGAAGCGCTGAAACCAGTCAAATCAAGATAGCTACTCTGTCTACGTAGGAGTACC
BLAST of CU110512 vs. TrEMBL
Match: A0A0A0LAJ7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G251920 PE=4 SV=1) HSP 1 Score: 110.5 bits (275), Expect = 1.2e-21 Identity = 51/52 (98.08%), Postives = 52/52 (100.00%), Query Frame = -1
BLAST of CU110512 vs. NCBI nr
Match: gi|700202549|gb|KGN57682.1| (hypothetical protein Csa_3G251920 [Cucumis sativus]) HSP 1 Score: 111.3 bits (277), Expect = 1.0e-21 Identity = 51/52 (98.08%), Postives = 52/52 (100.00%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|