CU109410 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTAACTTGCCACTTCCAGTGCCTATTTTGTAAGGTTGACAAAATACCCAGTGGAGTTAGACTTGGTTTTATTCACAATTGGAGATGGAAAGACAGAAGTTCTCGTGTATATAGATTGCTTGGTTTTTCCTGCTACTGCCAGTAGTAGTCCAATTTTTTCGAGCCATAAGAAATGGACGCTTAAAGGACCAGTCACCTCCTGGTGAACCGAGAATTATGAGAAGTCTTTTGGGTGCTTTGAAAAAATCAGTTGAAATTTCTAGAGTATGAGTTAATATTTGTCTATGTAAATGTACCAAACTTGTCTTTTCTTCTGTCATTAGGTAATGTAAATGACTGTCGGTGAAGGTTCACTC
BLAST of CU109410 vs. TrEMBL
Match: A0A0A0KFD4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G452740 PE=4 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 4.1e-10 Identity = 36/36 (100.00%), Postives = 36/36 (100.00%), Query Frame = 3
BLAST of CU109410 vs. TrEMBL
Match: A0A0A0KFD4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G452740 PE=4 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 5.1e-08 Identity = 33/52 (63.46%), Postives = 39/52 (75.00%), Query Frame = 2
HSP 2 Score: 64.3 bits (155), Expect = 1.1e-07 Identity = 32/36 (88.89%), Postives = 34/36 (94.44%), Query Frame = 3
BLAST of CU109410 vs. TrEMBL
Match: A0A0B0PCD0_GOSAR (Uncharacterized protein OS=Gossypium arboreum GN=F383_29840 PE=4 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 4.7e-06 Identity = 28/41 (68.29%), Postives = 32/41 (78.05%), Query Frame = 2
HSP 2 Score: 63.9 bits (154), Expect = 1.5e-07 Identity = 28/36 (77.78%), Postives = 35/36 (97.22%), Query Frame = 3
BLAST of CU109410 vs. TrEMBL
Match: W1PZL7_AMBTC (Uncharacterized protein OS=Amborella trichopoda GN=AMTR_s00040p00113110 PE=4 SV=1) HSP 1 Score: 40.4 bits (93), Expect = 1.7e+00 Identity = 20/36 (55.56%), Postives = 24/36 (66.67%), Query Frame = 2
HSP 2 Score: 63.9 bits (154), Expect = 1.5e-07 Identity = 32/36 (88.89%), Postives = 34/36 (94.44%), Query Frame = 3
BLAST of CU109410 vs. TrEMBL
Match: A0A0D2NT44_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_006G153100 PE=4 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 4.0e-05 Identity = 26/41 (63.41%), Postives = 31/41 (75.61%), Query Frame = 2
HSP 2 Score: 63.9 bits (154), Expect = 1.5e-07 Identity = 32/36 (88.89%), Postives = 34/36 (94.44%), Query Frame = 3
BLAST of CU109410 vs. NCBI nr
Match: gi|449451154|ref|XP_004143327.1| (PREDICTED: uncharacterized protein LOC101214488 [Cucumis sativus]) HSP 1 Score: 72.4 bits (176), Expect = 5.9e-10 Identity = 36/36 (100.00%), Postives = 36/36 (100.00%), Query Frame = 3
BLAST of CU109410 vs. NCBI nr
Match: gi|659125240|ref|XP_008462584.1| (PREDICTED: uncharacterized protein LOC103500909 [Cucumis melo]) HSP 1 Score: 72.4 bits (176), Expect = 5.9e-10 Identity = 36/36 (100.00%), Postives = 36/36 (100.00%), Query Frame = 3
BLAST of CU109410 vs. NCBI nr
Match: gi|719974756|ref|XP_010245745.1| (PREDICTED: uncharacterized protein LOC104589201 [Nelumbo nucifera]) HSP 1 Score: 65.9 bits (159), Expect = 5.5e-08 Identity = 32/36 (88.89%), Postives = 35/36 (97.22%), Query Frame = 3
BLAST of CU109410 vs. NCBI nr
Match: gi|728843137|gb|KHG22580.1| (hypothetical protein F383_29840 [Gossypium arboreum]) HSP 1 Score: 64.3 bits (155), Expect = 1.6e-07 Identity = 32/36 (88.89%), Postives = 34/36 (94.44%), Query Frame = 3
BLAST of CU109410 vs. NCBI nr
Match: gi|769803430|ref|XP_006851459.2| (PREDICTED: uncharacterized protein LOC18441278 isoform X1 [Amborella trichopoda]) HSP 1 Score: 63.9 bits (154), Expect = 2.1e-07 Identity = 28/36 (77.78%), Postives = 35/36 (97.22%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|