CU109024 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU109024
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	No hit
Location	Chr3 : 14968064 .. 14968194 (+)
Sequence length	135

The following sequences are available for this feature:

CCCTTAATTTTTGGGGATTTTTGAACCCTTTGAAGCTCCTGTAATAATCCAATCTGATCTATTTCAAAGTGATTTTTCCAATCCTATTGATTTATGTAGAATAAATTCAGTGATTTTAGATGAAGGGCTCCAAAG


Library category	ESTs
hermaphrodite flower library	2

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa3G229370	Csa3G229370	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
H0015202	H0015202	EST
H0081907	H0081907	EST