CU108758 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU108758
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	No hit
Location	Chr1 : 2389131 .. 2398576 (-)
Sequence length	127

The following sequences are available for this feature:

GGAAAGGGAAGAGGTTGAAAAGCTTAGAGAAAGAAGAGGAGAAATCAACTAGAGAAGTGGTTCATGTTAGAGCTAGAAAGAAGGACCAAAGCCACTGATAGCCACAGTTTAGCTGAAAAGGGAAAAA


Library category	ESTs
hermaphrodite flower library	2

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

The following terms have been associated with this transcribed_cluster:

Vocabulary: **INTERPRO**
Term	Definition

This transcribed_cluster is associated with the following gene feature(s):

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
H0052195	H0052195	EST
H0191476	H0191476	EST

Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16


IPR Term	IPR Description	Source	Source Term	Source Description	Alignment
None	No IPR available	unknown	Coil	Coil	coord: 6..26 scor