CU108627 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTTCTGGGACCTATTGGAAGCTTAACGTTCGAAGGTAGACTTTCATGGAAGACAAGAATACTAGCGTTCATTTTCGAACGAGTTCGAATAAAAATTGGACCTTTAAACCCTTTAGAGATTAGTCTTGGTCAAAAAGAAGAAAGGGAGCCAAGCACCGAGGATCCTTGCTTTATCTGGTTTTATGTTGATGAGGAAATAGCTGTTGCTCGTGGTAGAAGTGGGGGAACTGCATTTTGGTGCCGGTGTCGCCGTGTCAATACTTAGTTCTTTTCTCCATCAGATATTTGATCTTCTGCTTTGTACATGTCGAATTTTGTTATTGTCTTGTATCAAATTATCATGTACCTCGACGCTGTCATATTCAAATGTTCAATGTGCTATATTTATTGC
BLAST of CU108627 vs. TrEMBL
Match: A0A0A0LPV7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G024850 PE=4 SV=1) HSP 1 Score: 183.3 bits (464), Expect = 1.8e-43 Identity = 86/87 (98.85%), Postives = 87/87 (100.00%), Query Frame = 1
BLAST of CU108627 vs. TrEMBL
Match: B9I2H3_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0012s04760g PE=4 SV=1) HSP 1 Score: 165.6 bits (418), Expect = 4.0e-38 Identity = 76/87 (87.36%), Postives = 82/87 (94.25%), Query Frame = 1
BLAST of CU108627 vs. TrEMBL
Match: A0A067KSD2_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_05352 PE=4 SV=1) HSP 1 Score: 163.7 bits (413), Expect = 1.5e-37 Identity = 74/87 (85.06%), Postives = 81/87 (93.10%), Query Frame = 1
BLAST of CU108627 vs. TrEMBL
Match: A0A061G2E9_THECC (Uncharacterized protein OS=Theobroma cacao GN=TCM_012562 PE=4 SV=1) HSP 1 Score: 161.8 bits (408), Expect = 5.7e-37 Identity = 72/87 (82.76%), Postives = 80/87 (91.95%), Query Frame = 1
BLAST of CU108627 vs. TrEMBL
Match: A0A0B2QP31_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_023505 PE=4 SV=1) HSP 1 Score: 161.4 bits (407), Expect = 7.5e-37 Identity = 72/86 (83.72%), Postives = 80/86 (93.02%), Query Frame = 1
BLAST of CU108627 vs. NCBI nr
Match: gi|449439107|ref|XP_004137329.1| (PREDICTED: uncharacterized protein LOC101217184 [Cucumis sativus]) HSP 1 Score: 187.6 bits (475), Expect = 1.4e-44 Identity = 86/87 (98.85%), Postives = 87/87 (100.00%), Query Frame = 1
BLAST of CU108627 vs. NCBI nr
Match: gi|659106855|ref|XP_008453454.1| (PREDICTED: uncharacterized protein LOC103494159 [Cucumis melo]) HSP 1 Score: 187.6 bits (475), Expect = 1.4e-44 Identity = 86/87 (98.85%), Postives = 87/87 (100.00%), Query Frame = 1
BLAST of CU108627 vs. NCBI nr
Match: gi|224118714|ref|XP_002317888.1| (hypothetical protein POPTR_0012s04760g [Populus trichocarpa]) HSP 1 Score: 169.9 bits (429), Expect = 3.0e-39 Identity = 76/87 (87.36%), Postives = 82/87 (94.25%), Query Frame = 1
BLAST of CU108627 vs. NCBI nr
Match: gi|743890614|ref|XP_011039098.1| (PREDICTED: uncharacterized protein LOC105135767 isoform X1 [Populus euphratica]) HSP 1 Score: 169.9 bits (429), Expect = 3.0e-39 Identity = 76/87 (87.36%), Postives = 82/87 (94.25%), Query Frame = 1
BLAST of CU108627 vs. NCBI nr
Match: gi|743890618|ref|XP_011039099.1| (PREDICTED: uncharacterized protein LOC105135767 isoform X2 [Populus euphratica]) HSP 1 Score: 169.9 bits (429), Expect = 3.0e-39 Identity = 76/87 (87.36%), Postives = 82/87 (94.25%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|