CU107675 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGTCAAAATTTCACCTTTTAACTACGGGCGCACGTAACCAATGCATACACACAATGATAAATCAGCCATCTAGGGACCTAAACTAATACATTAAGCATTTGGCATTTTAAGATTGCTCAAAACCCAATGCATATGAGATTTAGAGGTTAAATACATCTTTCTAAACAATTGTACATAAATTCTGCCTCTAAAAGCCGAAGTAATAACATACCATATGTCAGCCAGCACGTTTCTTTGTTCTTCAGTTTTGATTGTTGTTGTTCGTAATAGACTTGTACAATGTAATAACAAATGAGTAAAATTTCATCTTTTCCACTTGTCAATCTCCTTTGAAGTAGCTCGGATAAGTCTCTTTGTATTTAGGACAAGGTCGTCAACAAGCGCGCCGATATCGTCCTGATGAGGAAAAATACTTTGACGACCACGCAATACATCCCCC
BLAST of CU107675 vs. TrEMBL
Match: A0A0A0KSM8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G646690 PE=4 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 8.2e-16 Identity = 44/44 (100.00%), Postives = 44/44 (100.00%), Query Frame = -2
BLAST of CU107675 vs. TrEMBL
Match: A0A059BYF4_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_F04100 PE=4 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 9.1e-07 Identity = 30/44 (68.18%), Postives = 37/44 (84.09%), Query Frame = -2
BLAST of CU107675 vs. TrEMBL
Match: A0A059BXQ6_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_F04100 PE=4 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 9.1e-07 Identity = 30/44 (68.18%), Postives = 37/44 (84.09%), Query Frame = -2
BLAST of CU107675 vs. TrEMBL
Match: A0A0B2R6S3_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_033012 PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 2.0e-06 Identity = 30/44 (68.18%), Postives = 37/44 (84.09%), Query Frame = -2
BLAST of CU107675 vs. TrEMBL
Match: I1L3L5_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_09G154800 PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 2.0e-06 Identity = 30/44 (68.18%), Postives = 37/44 (84.09%), Query Frame = -2
BLAST of CU107675 vs. NCBI nr
Match: gi|449447517|ref|XP_004141514.1| (PREDICTED: glycine-rich cell wall structural protein 1 [Cucumis sativus]) HSP 1 Score: 94.4 bits (233), Expect = 1.8e-16 Identity = 44/44 (100.00%), Postives = 44/44 (100.00%), Query Frame = -2
BLAST of CU107675 vs. NCBI nr
Match: gi|659119131|ref|XP_008459493.1| (PREDICTED: glycine-rich cell wall structural protein 1 [Cucumis melo]) HSP 1 Score: 91.3 bits (225), Expect = 1.5e-15 Identity = 42/44 (95.45%), Postives = 43/44 (97.73%), Query Frame = -2
BLAST of CU107675 vs. NCBI nr
Match: gi|702381809|ref|XP_010063733.1| (PREDICTED: glycine-rich cell wall structural protein 2 [Eucalyptus grandis]) HSP 1 Score: 64.3 bits (155), Expect = 2.0e-07 Identity = 30/44 (68.18%), Postives = 37/44 (84.09%), Query Frame = -2
BLAST of CU107675 vs. NCBI nr
Match: gi|629105525|gb|KCW70994.1| (hypothetical protein EUGRSUZ_F04100 [Eucalyptus grandis]) HSP 1 Score: 64.3 bits (155), Expect = 2.0e-07 Identity = 30/44 (68.18%), Postives = 37/44 (84.09%), Query Frame = -2
BLAST of CU107675 vs. NCBI nr
Match: gi|356530965|ref|XP_003534049.1| (PREDICTED: keratin, type II cuticular Hb4-like [Glycine max]) HSP 1 Score: 63.2 bits (152), Expect = 4.5e-07 Identity = 30/44 (68.18%), Postives = 37/44 (84.09%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|