CU105305 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCCCAAGAATCGCCTTCTTTCTTGAAAATGAATGGAGAGCGATCGGTGTTCAACAAAGCCGTGGATGGGTTCATTATGCAATTCATCGCCCCAGAGCCACACATAATGTTGTTCAGAAGGCCACTCAAACTATCAACAGCAGCAAGAGAATCAAGCACAACAGCAGATTTTGGCCAAGTAAATTGGTTTATTGTCCTTTTTTTTCCTTTTAGACACACTATAATGAGAAATATCTCACTACAAAACATAAAAAAATTAAAGTGTTTGTGGTTTGTTGTGTGGTGTAGTTTCCTTCTCCAATTTGGAGAAGCTTTGTGGCCCAGTTAGATCTTTGTCATAGTCATTAATCAATTCCCCACCATTGTTCATGAATTTGTGGTTTTAATTTGCTTTTGATATAAGCGTGGTTCTTATCTTACTAAAAACTT
BLAST of CU105305 vs. Swiss-Prot
Match: CKS1_ORYSI (Cyclin-dependent kinases regulatory subunit 1 OS=Oryza sativa subsp. indica GN=CKS1 PE=2 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 1.9e-07 Identity = 24/30 (80.00%), Postives = 23/30 (76.67%), Query Frame = 3
HSP 2 Score: 31.2 bits (69), Expect = 1.1e+01 Identity = 13/25 (52.00%), Postives = 13/25 (52.00%), Query Frame = 1
BLAST of CU105305 vs. Swiss-Prot
Match: CKS1_ORYSJ (Cyclin-dependent kinases regulatory subunit 1 OS=Oryza sativa subsp. japonica GN=CKS1 PE=2 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 1.9e-07 Identity = 24/30 (80.00%), Postives = 23/30 (76.67%), Query Frame = 3
HSP 2 Score: 31.2 bits (69), Expect = 1.1e+01 Identity = 13/25 (52.00%), Postives = 13/25 (52.00%), Query Frame = 1
BLAST of CU105305 vs. Swiss-Prot
Match: CKS1_ARATH (Cyclin-dependent kinases regulatory subunit 1 OS=Arabidopsis thaliana GN=CKS1 PE=1 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 2.5e-07 Identity = 23/30 (76.67%), Postives = 23/30 (76.67%), Query Frame = 3
HSP 2 Score: 30.4 bits (67), Expect = 2.0e+01 Identity = 12/12 (100.00%), Postives = 10/12 (83.33%), Query Frame = 1
BLAST of CU105305 vs. Swiss-Prot
Match: CKS2_ARATH (Cyclin-dependent kinases regulatory subunit 2 OS=Arabidopsis thaliana GN=CKS2 PE=3 SV=1) HSP 1 Score: 55.1 bits (131), Expect = 7.4e-07 Identity = 23/30 (76.67%), Postives = 23/30 (76.67%), Query Frame = 3
HSP 2 Score: 30.4 bits (67), Expect = 2.0e+01 Identity = 12/12 (100.00%), Postives = 10/12 (83.33%), Query Frame = 1
BLAST of CU105305 vs. TrEMBL
Match: A0A078J2N3_BRANA (Cyclin-dependent kinases regulatory subunit OS=Brassica napus GN=BnaC03g77050D PE=3 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 7.5e-06 Identity = 30/57 (52.63%), Postives = 34/57 (59.65%), Query Frame = 3
BLAST of CU105305 vs. TrEMBL
Match: J3LJZ4_ORYBR (Cyclin-dependent kinases regulatory subunit OS=Oryza brachyantha PE=3 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 9.7e-06 Identity = 31/65 (47.69%), Postives = 36/65 (55.38%), Query Frame = 3
BLAST of CU105305 vs. NCBI nr
Match: gi|923689830|ref|XP_013656211.1| (PREDICTED: cyclin-dependent kinases regulatory subunit 1-like [Brassica napus]) HSP 1 Score: 59.3 bits (142), Expect = 6.3e-06 Identity = 30/57 (52.63%), Postives = 34/57 (59.65%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|