CU105135 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GATTGCATCCTTTACTAAAGCCCTTCGTTATTTATGGAATAATAATAGTATATGAAATATTTGAAGTGACAACCTTGACAAGTGAAGAGAGGTAGTAATAGTTGTAGTTTGGCTTACTCCCATAGTGTCCTACTTAACTGTCTTACCTGTAGAGACAGATGATGGTTGCACTGGTTGCGATGGCTTCGTCGTGTCGGGGACATCTTCCGGTGGCACGACGACACCCGGCCAAGGGTGGCAGTTGCAGTGCTTCCCCTTCTCTACGCTCTTGTAGAGACCAGGAAGGTGGCGGCCACACCCCTTCCATGTATATTTGCTGCAATCCTACAAACCACTAGACAATAAACAAACAAATCTACTACTCTCTCT
BLAST of CU105135 vs. TrEMBL
Match: A0A0A0LJK5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G287170 PE=4 SV=1) HSP 1 Score: 87.4 bits (215), Expect = 1.3e-14 Identity = 40/64 (62.50%), Postives = 40/64 (62.50%), Query Frame = -1
BLAST of CU105135 vs. NCBI nr
Match: gi|700206916|gb|KGN62035.1| (hypothetical protein Csa_2G287170 [Cucumis sativus]) HSP 1 Score: 87.8 bits (216), Expect = 1.4e-14 Identity = 40/64 (62.50%), Postives = 40/64 (62.50%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|