CU103110 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAAAGAAGTGAATGGTTGAGTTGAAGAGGCGAAAATCGCGATTCATACTAAGACAGCTTCTATATAAAGAGGTCCTCCAAAGTCGGGGAAAATCGCTCGCAACAAAATTTTCGACGTCAACAAAGAGGGAGAAAAGCGCTGTCAGTTCCTTCAACGTTTTGCTGCACCCGTGGAATGCAGCAAAGAGGAAGACTAAACACCCGAAGATCCAGGAGCTTTTCCAGATCCCGCCTCGCCGTTGAGGGTTCATAGGCTTAACCTTGCTTAAATTCCTCCTCCTCCTCTTCATTCTTACTCTTTCTATCTTGTTTCTAATCATTCGCAATGGCTTCTGTTAACAATGGCGGTATACTCTCTTTCTCTTTATACTTGTGTTCGTACATTCTCCGATTTTCTATTGTAATGATTTTCTGATTCGATCCGCTGCGTTGTTTTTT
BLAST of CU103110 vs. NCBI nr
Match: gi|700209078|gb|KGN64174.1| (hypothetical protein Csa_1G042810 [Cucumis sativus]) HSP 1 Score: 131.3 bits (329), Expect = 1.3e-27 Identity = 61/61 (100.00%), Postives = 61/61 (100.00%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|