CU102895 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGAGGGAGAATTGCTGGGCATCTGATGGTAACTATTATGCAAAAGTCTTGGATATGATGAAGATGAGGATGAAAGATTTTCCAATCCAACTGGAAGCCAGAACTCAACTGCAACTGTCTTTGGACAACATTTTGTATGGTTGTAGTTCAATTTCCAACTTTTATGTTTGTTGTGCTAGATAAAATTGGGTAGCCCCCCACAATGAGATTCCCTTACACTTTCTATTAGTATCTGCAGACTAAAA
BLAST of CU102895 vs. TrEMBL
Match: A0A0A0L365_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G622220 PE=4 SV=1) HSP 1 Score: 122.9 bits (307), Expect = 1.9e-25 Identity = 57/59 (96.61%), Postives = 57/59 (96.61%), Query Frame = 2
BLAST of CU102895 vs. NCBI nr
Match: gi|700199854|gb|KGN55012.1| (hypothetical protein Csa_4G622220 [Cucumis sativus]) HSP 1 Score: 124.0 bits (310), Expect = 1.2e-25 Identity = 57/59 (96.61%), Postives = 57/59 (96.61%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|