CU102622 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGTATGCAATAATTAATGGTATTTAATTTCACAAAACCCTAATGTTTAAACAAAAATAGAAGAAAATTGATAATCCTACAATGAACCAAAAACATTAAGAAAAGATAGTGAACTATGAAATGCAAAGATGAATTAATATAAACATAATGAAACAGGGTGGGGTGGGAACTATGGTTATGAATTTGTGTACCAAAAATATCCATTAACAATATCATAGAAAGAGAAGGGAACTAATTATTATTACTAATTAAGAAAGAGCTCAAGTTGAGAAGTGTTTTCCTGATCAAGGACATCAAGGAAGACGGGATCAACGGTGAGATGGCTGTCCACGTGGACCTTGAATTTGTGACTCCACCACAGCACTCTCGCCAAAACCCCC
BLAST of CU102622 vs. TrEMBL
Match: A0A0A0KGW5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G425170 PE=4 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 1.6e-15 Identity = 42/44 (95.45%), Postives = 42/44 (95.45%), Query Frame = -2
BLAST of CU102622 vs. TrEMBL
Match: A0A0D2MRV6_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_004G010300 PE=4 SV=1) HSP 1 Score: 79.0 bits (193), Expect = 4.7e-12 Identity = 34/43 (79.07%), Postives = 39/43 (90.70%), Query Frame = -2
BLAST of CU102622 vs. TrEMBL
Match: A0A0S3SBZ9_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.06G164300 PE=4 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 1.1e-11 Identity = 32/40 (80.00%), Postives = 38/40 (95.00%), Query Frame = -2
BLAST of CU102622 vs. TrEMBL
Match: A0A0L9V6C7_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan08g136500 PE=4 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 1.1e-11 Identity = 32/40 (80.00%), Postives = 38/40 (95.00%), Query Frame = -2
BLAST of CU102622 vs. TrEMBL
Match: A0A061GU68_THECC (Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family OS=Theobroma cacao GN=TCM_041382 PE=4 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 1.4e-11 Identity = 34/43 (79.07%), Postives = 38/43 (88.37%), Query Frame = -2
BLAST of CU102622 vs. NCBI nr
Match: gi|449444795|ref|XP_004140159.1| (PREDICTED: uncharacterized protein LOC101218134 [Cucumis sativus]) HSP 1 Score: 93.6 bits (231), Expect = 2.7e-16 Identity = 42/44 (95.45%), Postives = 42/44 (95.45%), Query Frame = -2
BLAST of CU102622 vs. NCBI nr
Match: gi|700192825|gb|KGN48029.1| (hypothetical protein Csa_6G425170 [Cucumis sativus]) HSP 1 Score: 93.6 bits (231), Expect = 2.7e-16 Identity = 42/44 (95.45%), Postives = 42/44 (95.45%), Query Frame = -2
BLAST of CU102622 vs. NCBI nr
Match: gi|659097347|ref|XP_008449575.1| (PREDICTED: uncharacterized protein LOC103491417 [Cucumis melo]) HSP 1 Score: 92.4 bits (228), Expect = 5.9e-16 Identity = 41/44 (93.18%), Postives = 42/44 (95.45%), Query Frame = -2
BLAST of CU102622 vs. NCBI nr
Match: gi|1012030096|ref|XP_015951817.1| (PREDICTED: uncharacterized protein LOC107476511 [Arachis duranensis]) HSP 1 Score: 81.6 bits (200), Expect = 1.0e-12 Identity = 34/39 (87.18%), Postives = 37/39 (94.87%), Query Frame = -2
BLAST of CU102622 vs. NCBI nr
Match: gi|823145952|ref|XP_012472857.1| (PREDICTED: uncharacterized protein LOC105790021 [Gossypium raimondii]) HSP 1 Score: 81.6 bits (200), Expect = 1.0e-12 Identity = 34/43 (79.07%), Postives = 39/43 (90.70%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|