CU102596 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAAAACAGTTAACAGCTAGCCACTTGGCTTCCCTACTCTCTCCTTACTCCTTCATATTCTTCTCTTCACGTTTTCATTTTCTCCAACTTCTTTTATCCTCTCTCAACATTTTTTCTCATCTGCTTCATTTCTTTCTTCCTCAGTTCTCTTCTGCTTCATTTCTTTCTTGATAAGCATCTTGATTCCCCATAATGACAGACCTTGAGGCCTCCAAGCCACAAAAGAGGAAGAAAGGCTGGGTGGACATCTTGGTTAATTTTCGCTGGATTATAGTTATTTTTGTAGTTCTCCCGTTCTCATTCAGTTTCTACTTCATCCAATATCTTGGAGACAAACGATCAGAGAGGAAGTCGTACAAGCAGCG
BLAST of CU102596 vs. Swiss-Prot
Match: DIM_PEA (Delta(24)-sterol reductase OS=Pisum sativum GN=DIM PE=1 SV=1) HSP 1 Score: 79.3 bits (194), Expect = 3.1e-14 Identity = 38/56 (67.86%), Postives = 42/56 (75.00%), Query Frame = 3
BLAST of CU102596 vs. Swiss-Prot
Match: DIM_ARATH (Delta(24)-sterol reductase OS=Arabidopsis thaliana GN=DIM PE=1 SV=2) HSP 1 Score: 71.6 bits (174), Expect = 6.5e-12 Identity = 35/58 (60.34%), Postives = 43/58 (74.14%), Query Frame = 3
BLAST of CU102596 vs. TrEMBL
Match: A0A0A0KZ82_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G103350 PE=4 SV=1) HSP 1 Score: 119.8 bits (299), Expect = 2.3e-24 Identity = 57/57 (100.00%), Postives = 57/57 (100.00%), Query Frame = 3
BLAST of CU102596 vs. TrEMBL
Match: F6HGH6_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_01s0010g01200 PE=4 SV=1) HSP 1 Score: 88.6 bits (218), Expect = 5.7e-15 Identity = 42/60 (70.00%), Postives = 48/60 (80.00%), Query Frame = 3
BLAST of CU102596 vs. TrEMBL
Match: A0A068VAI8_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00005100001 PE=4 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 1.4e-13 Identity = 42/60 (70.00%), Postives = 46/60 (76.67%), Query Frame = 3
BLAST of CU102596 vs. TrEMBL
Match: S8CYE4_9LAMI (Uncharacterized protein (Fragment) OS=Genlisea aurea GN=M569_04718 PE=4 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.8e-13 Identity = 41/57 (71.93%), Postives = 43/57 (75.44%), Query Frame = 3
BLAST of CU102596 vs. TrEMBL
Match: W9SYN1_9ROSA (Delta(24)-sterol reductase OS=Morus notabilis GN=L484_014984 PE=4 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 2.4e-13 Identity = 39/57 (68.42%), Postives = 45/57 (78.95%), Query Frame = 3
BLAST of CU102596 vs. NCBI nr
Match: gi|449438803|ref|XP_004137177.1| (PREDICTED: delta(24)-sterol reductase-like [Cucumis sativus]) HSP 1 Score: 119.0 bits (297), Expect = 5.6e-24 Identity = 57/57 (100.00%), Postives = 57/57 (100.00%), Query Frame = 3
BLAST of CU102596 vs. NCBI nr
Match: gi|659120557|ref|XP_008460246.1| (PREDICTED: delta(24)-sterol reductase-like [Cucumis melo]) HSP 1 Score: 114.8 bits (286), Expect = 1.1e-22 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 3
BLAST of CU102596 vs. NCBI nr
Match: gi|297738246|emb|CBI27447.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 87.8 bits (216), Expect = 1.4e-14 Identity = 42/60 (70.00%), Postives = 48/60 (80.00%), Query Frame = 3
BLAST of CU102596 vs. NCBI nr
Match: gi|743782362|ref|XP_011016908.1| (PREDICTED: delta(24)-sterol reductase-like [Populus euphratica]) HSP 1 Score: 83.2 bits (204), Expect = 3.4e-13 Identity = 40/57 (70.18%), Postives = 44/57 (77.19%), Query Frame = 3
BLAST of CU102596 vs. NCBI nr
Match: gi|661878638|emb|CDP17594.1| (unnamed protein product [Coffea canephora]) HSP 1 Score: 83.2 bits (204), Expect = 3.4e-13 Identity = 42/60 (70.00%), Postives = 46/60 (76.67%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|