CU102516 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCTTCGATGGTTGTCCAGTATGTCAAATTATATTCAAGCAATGGAAAGAAGACAATCGTGTTATAAGATTTACAACATGGTGCAGAGATACATACTCTTTGTTTGAGGAGAACCACTAACGACCCACGTGTTTGCAGCAATAGATGCTTGAACCTTTGGGTTGTTGAATTGGATAACCACATCATCCTTGAAAATGTTGACCTCCTCAATAGCAGGAATGGCATTCACCCCAATTCTCTTTAAAGTACTCTGGAGCCTTTTGTCATCTAGTTTGTAGTGGTCTTATGAACTGCCTTCTTCTTTCTTCTCACAGTACCCTTTCCACCAGTGCGAACGGCACTGGCAATCTTTCTAAGCCTCTCCTGATCCATCTTTGGGCTAGGGTTTTGGAGTTAGGGGATAAGACTGAGGGTCGCGGAAGAAAAGACGAAAACTACCCGGACGGCGCTAACCCCCGGCCG
BLAST of CU102516 vs. Swiss-Prot
Match: BTF3_ARATH (Basic transcription factor 3 OS=Arabidopsis thaliana GN=BTF3 PE=1 SV=1) HSP 1 Score: 110.9 bits (276), Expect = 1.2e-23 Identity = 55/59 (93.22%), Postives = 55/59 (93.22%), Query Frame = -3
BLAST of CU102516 vs. Swiss-Prot
Match: BTF3L_ARATH (Nascent polypeptide-associated complex subunit beta OS=Arabidopsis thaliana GN=At1g73230 PE=2 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 3.6e-23 Identity = 53/59 (89.83%), Postives = 55/59 (93.22%), Query Frame = -3
BLAST of CU102516 vs. Swiss-Prot
Match: BT3L4_DANRE (Transcription factor BTF3 homolog 4 OS=Danio rerio GN=btf3l4 PE=2 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 1.7e-12 Identity = 36/60 (60.00%), Postives = 46/60 (76.67%), Query Frame = -3
BLAST of CU102516 vs. Swiss-Prot
Match: BT3L4_XENTR (Transcription factor BTF3 homolog 4 OS=Xenopus tropicalis GN=btf3l4 PE=2 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 3.7e-12 Identity = 35/60 (58.33%), Postives = 45/60 (75.00%), Query Frame = -3
BLAST of CU102516 vs. Swiss-Prot
Match: BT3L4_XENLA (Transcription factor BTF3 homolog 4 OS=Xenopus laevis GN=btf3l4 PE=2 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 3.7e-12 Identity = 35/60 (58.33%), Postives = 45/60 (75.00%), Query Frame = -3
BLAST of CU102516 vs. TrEMBL
Match: A0A0A0LPY4_CUCSA (Nascent polypeptide-associated complex subunit beta OS=Cucumis sativus GN=Csa_1G031860 PE=3 SV=1) HSP 1 Score: 115.5 bits (288), Expect = 5.5e-23 Identity = 57/59 (96.61%), Postives = 58/59 (98.31%), Query Frame = -3
BLAST of CU102516 vs. TrEMBL
Match: A0A0A0LTU8_CUCSA (Nascent polypeptide-associated complex subunit beta OS=Cucumis sativus GN=Csa_1G043055 PE=3 SV=1) HSP 1 Score: 114.0 bits (284), Expect = 1.6e-22 Identity = 66/114 (57.89%), Postives = 70/114 (61.40%), Query Frame = -3
BLAST of CU102516 vs. TrEMBL
Match: A0A0S3SDP6_PHAAN (Nascent polypeptide-associated complex subunit beta OS=Vigna angularis var. angularis GN=Vigan.06G226000 PE=3 SV=1) HSP 1 Score: 112.8 bits (281), Expect = 3.6e-22 Identity = 56/60 (93.33%), Postives = 58/60 (96.67%), Query Frame = -3
BLAST of CU102516 vs. TrEMBL
Match: A0A0L9V773_PHAAN (Nascent polypeptide-associated complex subunit beta OS=Phaseolus angularis GN=LR48_Vigan08g175200 PE=3 SV=1) HSP 1 Score: 112.8 bits (281), Expect = 3.6e-22 Identity = 56/60 (93.33%), Postives = 58/60 (96.67%), Query Frame = -3
BLAST of CU102516 vs. TrEMBL
Match: V7AI72_PHAVU (Nascent polypeptide-associated complex subunit beta OS=Phaseolus vulgaris GN=PHAVU_011G041900g PE=3 SV=1) HSP 1 Score: 112.1 bits (279), Expect = 6.1e-22 Identity = 56/59 (94.92%), Postives = 57/59 (96.61%), Query Frame = -3
BLAST of CU102516 vs. NCBI nr
Match: gi|449439237|ref|XP_004137393.1| (PREDICTED: transcription factor BTF3 homolog 4-like isoform X1 [Cucumis sativus]) HSP 1 Score: 116.3 bits (290), Expect = 4.7e-23 Identity = 57/59 (96.61%), Postives = 58/59 (98.31%), Query Frame = -3
BLAST of CU102516 vs. NCBI nr
Match: gi|659066315|ref|XP_008438373.1| (PREDICTED: transcription factor BTF3 homolog 4-like isoform X2 [Cucumis melo]) HSP 1 Score: 116.3 bits (290), Expect = 4.7e-23 Identity = 57/59 (96.61%), Postives = 58/59 (98.31%), Query Frame = -3
BLAST of CU102516 vs. NCBI nr
Match: gi|449439239|ref|XP_004137394.1| (PREDICTED: transcription factor BTF3 homolog 4-like isoform X2 [Cucumis sativus]) HSP 1 Score: 116.3 bits (290), Expect = 4.7e-23 Identity = 57/59 (96.61%), Postives = 58/59 (98.31%), Query Frame = -3
BLAST of CU102516 vs. NCBI nr
Match: gi|659066313|ref|XP_008438287.1| (PREDICTED: transcription factor BTF3 homolog 4-like isoform X1 [Cucumis melo]) HSP 1 Score: 116.3 bits (290), Expect = 4.7e-23 Identity = 57/59 (96.61%), Postives = 58/59 (98.31%), Query Frame = -3
BLAST of CU102516 vs. NCBI nr
Match: gi|700209106|gb|KGN64202.1| (hypothetical protein Csa_1G043055 [Cucumis sativus]) HSP 1 Score: 114.8 bits (286), Expect = 1.4e-22 Identity = 66/114 (57.89%), Postives = 70/114 (61.40%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|