CU102416 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACTAAGAAATATCAGCAGCATGGTTTTCTTTCCTGTACTAGGGTTTTCACGTAAATTTGTGTTTGTTCTACATCTCTACTTTCAATACCAACAAAACATGCATTTGGTTGTGGAAGATTACACATAAACCCTTGAAAACATAATAAGAATCAATGTGAGATAAAGAAGGAATTTAGAAACTCAGAACGGGATAAAGCAAAGAAAAATCAAGTGTTTCAGAAGCATAAAAATGTGAAGATCTGAACATGGAGGACTCACGATGGGCAGGCCAC
BLAST of CU102416 vs. TrEMBL
Match: A0A0A0LPT3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025910 PE=4 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 2.3e-08 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = -3
BLAST of CU102416 vs. NCBI nr
Match: gi|700208814|gb|KGN63910.1| (hypothetical protein Csa_1G025910 [Cucumis sativus]) HSP 1 Score: 63.2 bits (152), Expect = 2.8e-07 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|