CU102192 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGATATGCCAAACATTAGGTGGAGGAAATATAGATGTTTTGCACTTGACTCAAGAAAGATTGTTATTCTCTTCTCGGTATTGTCAAGCTTGGGAACCTTGATGTTGATATATTTGACTCTGAGAGTTAGGCAGCAGGGTGGAGATGGATCTGTTGCTATATAATTATAGTTTTTGGTCTCTGGTTTTGTCTAATTTTCTCCATTCTCTCTTAAAATAGTTGATTTTTAAATCTTAATCTCTTTATAGAACATTTTTTTAGGCATGACTATTTATGTTTGTACATAAATGTCTTCTACTTGTGATTATGAACGCTCTAGAAATTAGTGAACTTGTGATATTCGGATGAATCCTTGATGGAAATGTTAGCAGATTTTGAGTTTTATAAGATTATTGATCAAATTATTTTAGTTTCACATT
BLAST of CU102192 vs. TrEMBL
Match: A0A0A0KVQ5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G095580 PE=4 SV=1) HSP 1 Score: 106.3 bits (264), Expect = 3.1e-20 Identity = 52/53 (98.11%), Postives = 53/53 (100.00%), Query Frame = 2
BLAST of CU102192 vs. TrEMBL
Match: A0A067LED3_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_24035 PE=4 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 4.1e-09 Identity = 38/54 (70.37%), Postives = 43/54 (79.63%), Query Frame = 2
BLAST of CU102192 vs. TrEMBL
Match: A0A087GL08_ARAAL (Uncharacterized protein OS=Arabis alpina GN=AALP_AA7G277700 PE=4 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 9.2e-09 Identity = 35/51 (68.63%), Postives = 41/51 (80.39%), Query Frame = 2
BLAST of CU102192 vs. TrEMBL
Match: A0A087GL07_ARAAL (Uncharacterized protein OS=Arabis alpina GN=AALP_AA7G277700 PE=4 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 9.2e-09 Identity = 35/51 (68.63%), Postives = 41/51 (80.39%), Query Frame = 2
BLAST of CU102192 vs. TrEMBL
Match: V4P1N3_EUTSA (Uncharacterized protein OS=Eutrema salsugineum GN=EUTSA_v10026058mg PE=4 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 1.2e-08 Identity = 34/47 (72.34%), Postives = 40/47 (85.11%), Query Frame = 2
BLAST of CU102192 vs. NCBI nr
Match: gi|700198490|gb|KGN53648.1| (hypothetical protein Csa_4G095580 [Cucumis sativus]) HSP 1 Score: 106.7 bits (265), Expect = 3.4e-20 Identity = 52/53 (98.11%), Postives = 53/53 (100.00%), Query Frame = 2
BLAST of CU102192 vs. NCBI nr
Match: gi|778691787|ref|XP_011653351.1| (PREDICTED: uncharacterized protein LOC101221126 [Cucumis sativus]) HSP 1 Score: 106.7 bits (265), Expect = 3.4e-20 Identity = 52/53 (98.11%), Postives = 53/53 (100.00%), Query Frame = 2
BLAST of CU102192 vs. NCBI nr
Match: gi|659111140|ref|XP_008455600.1| (PREDICTED: uncharacterized protein LOC103495734 isoform X2 [Cucumis melo]) HSP 1 Score: 98.2 bits (243), Expect = 1.2e-17 Identity = 47/51 (92.16%), Postives = 49/51 (96.08%), Query Frame = 2
BLAST of CU102192 vs. NCBI nr
Match: gi|659111138|ref|XP_008455598.1| (PREDICTED: uncharacterized protein LOC103495734 isoform X1 [Cucumis melo]) HSP 1 Score: 98.2 bits (243), Expect = 1.2e-17 Identity = 47/51 (92.16%), Postives = 49/51 (96.08%), Query Frame = 2
BLAST of CU102192 vs. NCBI nr
Match: gi|729314866|ref|XP_010531374.1| (PREDICTED: uncharacterized protein LOC104807691 [Tarenaya hassleriana]) HSP 1 Score: 70.5 bits (171), Expect = 2.7e-09 Identity = 35/49 (71.43%), Postives = 41/49 (83.67%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|