CU102126 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TAGTTTGGTTCCTTATTTTACGGTTCCGGGGTTAGATCCTTCATAATCAATAATCTCATCGAAGCATAAGGATCCAAATCGTCTCAGAGACATGGCAACCCAAAAGCTTGCTACAATATCAATTGTTGTTTTGATGATATTCGCATGTATTGCATCAACAACAAAAGGAGACGTTTTGAATGTGCATTGTGTTCGACCATGCTCTGATACTTATGACGACGAGTCGTGTTATAATGATTGCATTCAAGAGAATCTTGGTGCTGGATTTTGTTACCCGAAACTACCTAGCACCGATAAAGATTGTTGTTGCAATGTTTGACAATAATTGATTGCGTAACATTTTATTGAAACTTATAAATAAAATTTAATATTTTACAATATCTCTTACC
BLAST of CU102126 vs. TrEMBL
Match: A0A0A0LHG9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G071930 PE=4 SV=1) HSP 1 Score: 164.9 bits (416), Expect = 6.7e-38 Identity = 75/75 (100.00%), Postives = 75/75 (100.00%), Query Frame = 2
BLAST of CU102126 vs. TrEMBL
Match: A0A0A0LJG5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G072430 PE=4 SV=1) HSP 1 Score: 154.5 bits (389), Expect = 9.1e-35 Identity = 69/74 (93.24%), Postives = 71/74 (95.95%), Query Frame = 2
BLAST of CU102126 vs. TrEMBL
Match: A0A0A0LKF5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G070930 PE=4 SV=1) HSP 1 Score: 122.1 bits (305), Expect = 5.0e-25 Identity = 50/53 (94.34%), Postives = 52/53 (98.11%), Query Frame = 2
BLAST of CU102126 vs. TrEMBL
Match: A0A0A0L1R8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G339000 PE=4 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 1.2e-10 Identity = 38/76 (50.00%), Postives = 50/76 (65.79%), Query Frame = 2
BLAST of CU102126 vs. NCBI nr
Match: gi|700206109|gb|KGN61228.1| (hypothetical protein Csa_2G071930 [Cucumis sativus]) HSP 1 Score: 164.9 bits (416), Expect = 9.6e-38 Identity = 75/75 (100.00%), Postives = 75/75 (100.00%), Query Frame = 2
BLAST of CU102126 vs. NCBI nr
Match: gi|700206110|gb|KGN61229.1| (hypothetical protein Csa_2G072430 [Cucumis sativus]) HSP 1 Score: 154.5 bits (389), Expect = 1.3e-34 Identity = 69/74 (93.24%), Postives = 71/74 (95.95%), Query Frame = 2
BLAST of CU102126 vs. NCBI nr
Match: gi|700206108|gb|KGN61227.1| (hypothetical protein Csa_2G070930 [Cucumis sativus]) HSP 1 Score: 124.4 bits (311), Expect = 1.4e-25 Identity = 50/53 (94.34%), Postives = 52/53 (98.11%), Query Frame = 2
BLAST of CU102126 vs. NCBI nr
Match: gi|700199339|gb|KGN54497.1| (hypothetical protein Csa_4G339000 [Cucumis sativus]) HSP 1 Score: 74.3 bits (181), Expect = 1.7e-10 Identity = 38/76 (50.00%), Postives = 50/76 (65.79%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|