CU102059 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GCTCCGGCCGCCTGGCGGCCGCGGGAATTCGATTAGCGTGGTCGCGGCCGAGGTACATCCCGACATCGGAATCTCTAGCAAAGCCATGGGGATTATGAACAGCTTCATCAACGACATTTTCGAGAAGCTCGCTCAGGAATCCTCAAAGCTCGCTCGCTACAACAAGAAGCCGACTATCACCTCTCGGGAGATCCAAACGGCGGTGCGCCTTGTTCTTCCTGGTGAGCTGGCTAAACACGCTGTCTCTGAGGGTACCAAGGCTGTTACCAAGTTCACTAGCTCTTAGATTCATAGTATTTTAGGGTTTTCTCGTAGTAAAAAAGCAGGATCACTTGTTCTGGATCGTGTATTTCTTTTCCTTTTGTTGCTATTTTTGGAATTGAATGAATGAAAATCGGTTTTACATAACCCGAATTCTTTTTGAC
BLAST of CU102059 vs. Swiss-Prot
Match: H2B1_ARATH (Histone H2B.1 OS=Arabidopsis thaliana GN=At1g07790 PE=1 SV=3) HSP 1 Score: 151.8 bits (382), Expect = 5.8e-36 Identity = 78/81 (96.30%), Postives = 77/81 (95.06%), Query Frame = 2
BLAST of CU102059 vs. Swiss-Prot
Match: H2B1_MEDTR (Probable histone H2B.1 OS=Medicago truncatula PE=3 SV=3) HSP 1 Score: 150.6 bits (379), Expect = 1.3e-35 Identity = 77/81 (95.06%), Postives = 77/81 (95.06%), Query Frame = 2
BLAST of CU102059 vs. Swiss-Prot
Match: H2B11_ARATH (Histone H2B.11 OS=Arabidopsis thaliana GN=At5g59910 PE=1 SV=5) HSP 1 Score: 150.6 bits (379), Expect = 1.3e-35 Identity = 77/81 (95.06%), Postives = 77/81 (95.06%), Query Frame = 2
BLAST of CU102059 vs. Swiss-Prot
Match: H2B3_ARATH (Histone H2B.3 OS=Arabidopsis thaliana GN=At2g28720 PE=1 SV=3) HSP 1 Score: 150.6 bits (379), Expect = 1.3e-35 Identity = 77/81 (95.06%), Postives = 77/81 (95.06%), Query Frame = 2
BLAST of CU102059 vs. Swiss-Prot
Match: H2B3_MEDTR (Probable histone H2B.3 OS=Medicago truncatula PE=3 SV=3) HSP 1 Score: 150.2 bits (378), Expect = 1.7e-35 Identity = 76/81 (93.83%), Postives = 77/81 (95.06%), Query Frame = 2
BLAST of CU102059 vs. TrEMBL
Match: A0A0A0KHC9_CUCSA (Histone H2B OS=Cucumis sativus GN=Csa_6G193620 PE=3 SV=1) HSP 1 Score: 151.8 bits (382), Expect = 6.4e-34 Identity = 78/81 (96.30%), Postives = 79/81 (97.53%), Query Frame = 2
BLAST of CU102059 vs. TrEMBL
Match: K4D554_SOLLC (Histone H2B OS=Solanum lycopersicum PE=3 SV=1) HSP 1 Score: 151.8 bits (382), Expect = 6.4e-34 Identity = 78/81 (96.30%), Postives = 79/81 (97.53%), Query Frame = 2
BLAST of CU102059 vs. TrEMBL
Match: K4C323_SOLLC (Histone H2B OS=Solanum lycopersicum PE=3 SV=1) HSP 1 Score: 151.8 bits (382), Expect = 6.4e-34 Identity = 78/81 (96.30%), Postives = 79/81 (97.53%), Query Frame = 2
BLAST of CU102059 vs. TrEMBL
Match: A0A0V0H223_SOLCH (Histone H2B OS=Solanum chacoense PE=3 SV=1) HSP 1 Score: 151.8 bits (382), Expect = 6.4e-34 Identity = 78/81 (96.30%), Postives = 79/81 (97.53%), Query Frame = 2
BLAST of CU102059 vs. TrEMBL
Match: A0A0V0GXG2_SOLCH (Histone H2B (Fragment) OS=Solanum chacoense PE=3 SV=1) HSP 1 Score: 151.8 bits (382), Expect = 6.4e-34 Identity = 78/81 (96.30%), Postives = 79/81 (97.53%), Query Frame = 2
BLAST of CU102059 vs. NCBI nr
Match: gi|970008248|ref|XP_015065005.1| (PREDICTED: histone H2B-like [Solanum pennellii]) HSP 1 Score: 150.6 bits (379), Expect = 2.1e-33 Identity = 78/81 (96.30%), Postives = 79/81 (97.53%), Query Frame = 2
BLAST of CU102059 vs. NCBI nr
Match: gi|449450686|ref|XP_004143093.1| (PREDICTED: histone H2B [Cucumis sativus]) HSP 1 Score: 150.6 bits (379), Expect = 2.1e-33 Identity = 78/81 (96.30%), Postives = 79/81 (97.53%), Query Frame = 2
BLAST of CU102059 vs. NCBI nr
Match: gi|21617908|gb|AAM66958.1| (histone H2B [Arabidopsis thaliana]) HSP 1 Score: 150.6 bits (379), Expect = 2.1e-33 Identity = 78/81 (96.30%), Postives = 79/81 (97.53%), Query Frame = 2
BLAST of CU102059 vs. NCBI nr
Match: gi|901803922|gb|KMZ62899.1| (putative histone H2B.1 [Zostera marina]) HSP 1 Score: 150.6 bits (379), Expect = 2.1e-33 Identity = 78/81 (96.30%), Postives = 79/81 (97.53%), Query Frame = 2
BLAST of CU102059 vs. NCBI nr
Match: gi|15223016|ref|NP_172258.1| (histone H2B [Arabidopsis thaliana]) HSP 1 Score: 150.6 bits (379), Expect = 2.1e-33 Identity = 78/81 (96.30%), Postives = 79/81 (97.53%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|