CU102018 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGCCGCCAGCGTGCTAACGGCCCCACCGGGAATTTCTTCTCGACAAATCCGGCTGTCGCGACGATATGCTCCACCATTCCGTCGAGGAGGGACGGCGGCGCGTGGCCCTCTCCATTCCATAACCACACGCGTGACATACCTCTGAGAACCGCCGTTGACATGGCGTGATTCATGTTTGTGCCATTTGAAAATAGAAGGGCTCAAATGGACGGCGAAGGTCAACACCACCGTCGAGCTGCTCAACGGCGACATTAGAAGGGAGATCACGGAGGGAGAGCGTGAGATGCACGCTTTTGATTATCTTCTTTGGGAGGTGATGTGAAGGGTAGATCAGATTCTGAATGAAGTTACTAGCGTTGAGGAGTAGGCGCGTGGCTTCGTCATTTGAAACGTAGAAGAGATCGAAACGTTGACCGGCGGAGGAGCCTTTGGCGTTGTTGAGAATTGTTATGTCGAAGCCTTTTGAGGCTTCGTGATTGGCCCATAGTGAAGTGAGGCCGACGACGGCGACGAGAAGGAGGCGGAGGGCGATGGCGTGATTGGAGAGGTGAGGAGAAGTGGGAGTGGTGGTGGGGGAGGGGGAGGTTGAGGAGATGAGAGGTTGAGAAAGGGATCGGCGGTTTTCCATGGTTGAAGGATAATTATAGAATTGATAGAGGGATTCGCCTTTGGTTGAACGTTTTC
BLAST of CU102018 vs. TrEMBL
Match: A0A0A0KGU9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G423460 PE=4 SV=1) HSP 1 Score: 188.0 bits (476), Expect = 1.3e-44 Identity = 101/147 (68.71%), Postives = 101/147 (68.71%), Query Frame = -3
BLAST of CU102018 vs. TrEMBL
Match: A0A0A0KGU9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G423460 PE=4 SV=1) HSP 1 Score: 115.9 bits (289), Expect = 6.3e-23 Identity = 57/68 (83.82%), Postives = 60/68 (88.24%), Query Frame = -2
HSP 2 Score: 103.2 bits (256), Expect = 4.2e-19 Identity = 49/84 (58.33%), Postives = 65/84 (77.38%), Query Frame = -3
BLAST of CU102018 vs. TrEMBL
Match: A0A061DSQ8_THECC (Plant basic secretory protein family protein, putative OS=Theobroma cacao GN=TCM_001874 PE=4 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 2.0e-05 Identity = 28/57 (49.12%), Postives = 37/57 (64.91%), Query Frame = -2
HSP 2 Score: 96.7 bits (239), Expect = 3.9e-17 Identity = 46/75 (61.33%), Postives = 60/75 (80.00%), Query Frame = -3
BLAST of CU102018 vs. TrEMBL
Match: V4VDE9_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10033364mg PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 7.5e-08 Identity = 29/56 (51.79%), Postives = 41/56 (73.21%), Query Frame = -2
HSP 2 Score: 92.0 bits (227), Expect = 9.7e-16 Identity = 44/85 (51.76%), Postives = 66/85 (77.65%), Query Frame = -3
BLAST of CU102018 vs. TrEMBL
Match: B9H816_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0005s22400g PE=4 SV=2) HSP 1 Score: 58.2 bits (139), Expect = 1.6e-05 Identity = 27/57 (47.37%), Postives = 40/57 (70.18%), Query Frame = -2
HSP 2 Score: 92.0 bits (227), Expect = 9.7e-16 Identity = 46/84 (54.76%), Postives = 68/84 (80.95%), Query Frame = -3
BLAST of CU102018 vs. NCBI nr
Match: gi|778716617|ref|XP_004140255.2| (PREDICTED: uncharacterized protein LOC101221763 [Cucumis sativus]) HSP 1 Score: 189.1 bits (479), Expect = 8.4e-45 Identity = 101/147 (68.71%), Postives = 101/147 (68.71%), Query Frame = -3
BLAST of CU102018 vs. NCBI nr
Match: gi|659097291|ref|XP_008449544.1| (PREDICTED: uncharacterized protein LOC103491397 [Cucumis melo]) HSP 1 Score: 178.7 bits (452), Expect = 1.1e-41 Identity = 91/102 (89.22%), Postives = 91/102 (89.22%), Query Frame = -3
BLAST of CU102018 vs. NCBI nr
Match: gi|590710556|ref|XP_007048861.1| (Plant basic secretory protein family protein, putative [Theobroma cacao]) HSP 1 Score: 103.6 bits (257), Expect = 4.6e-19 Identity = 49/84 (58.33%), Postives = 65/84 (77.38%), Query Frame = -3
BLAST of CU102018 vs. NCBI nr
Match: gi|719973609|ref|XP_010242107.1| (PREDICTED: uncharacterized protein LOC104586537 [Nelumbo nucifera]) HSP 1 Score: 98.2 bits (243), Expect = 1.9e-17 Identity = 47/86 (54.65%), Postives = 63/86 (73.26%), Query Frame = -3
BLAST of CU102018 vs. NCBI nr
Match: gi|567889314|ref|XP_006437179.1| (hypothetical protein CICLE_v10033364mg [Citrus clementina]) HSP 1 Score: 96.7 bits (239), Expect = 5.7e-17 Identity = 46/75 (61.33%), Postives = 60/75 (80.00%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|