CU100383 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATACTTGGGAAATGGGTAGAGGATCACATCCATTCCTTAGATGCAGATGGTATTCGAGCTCTAATTAATGTTCTTGACCTGGAAAATCCAGATTTATGGAAGTGGTTAACAGGCCAAGAGCAACCCCCTGAAGCTTTGAAAACAAATCCTGTATTTACTGGAGTGAAAGAGAAGGTGATAGACAATCTCAACAAACATGCCTCACCTGAGACAAGAACACCACCTGGCCAACAATGGGTAAGGGGTTGGGATGATTTCAAGAAAGGTCGAGATGGCCCCATAACAGGAAATCAGTAGCTCTTCCCTTTAACTTTATGCCTAATCTCTCTTTTAAGTATATAAGAACAGAAAAGCCCTGCTAAGGTTTCTATATAAATGGTAGATTGGGAATAAGTTAAACCAACAAAGACTTTGAAGGGAACATTATTTAGTGTCTCTCCCTTTAAACCCTTGATCTATTGTATATTAATAATTTTTTTCCTTGTATGCATTTAACGGTAACTACATTGTACCGATCTTGAACACTTTGTTGTTTTGATGTGCTTACCAATATAGATTGTATTTACTTTAACC
BLAST of CU100383 vs. Swiss-Prot
Match: SDAF2_ARATH (Succinate dehydrogenase assembly factor 2, mitochondrial OS=Arabidopsis thaliana GN=SDHAF2 PE=1 SV=1) HSP 1 Score: 157.9 bits (398), Expect = 1.1e-37 Identity = 66/98 (67.35%), Postives = 84/98 (85.71%), Query Frame = 1
BLAST of CU100383 vs. TrEMBL
Match: A0A0A0LKF9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G072460 PE=4 SV=1) HSP 1 Score: 214.2 bits (544), Expect = 1.4e-52 Identity = 98/98 (100.00%), Postives = 98/98 (100.00%), Query Frame = 1
BLAST of CU100383 vs. TrEMBL
Match: A0A068TQT2_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00022341001 PE=4 SV=1) HSP 1 Score: 173.3 bits (438), Expect = 2.8e-40 Identity = 74/98 (75.51%), Postives = 87/98 (88.78%), Query Frame = 1
BLAST of CU100383 vs. TrEMBL
Match: V4TAF7_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10032866mg PE=4 SV=1) HSP 1 Score: 172.9 bits (437), Expect = 3.6e-40 Identity = 73/98 (74.49%), Postives = 90/98 (91.84%), Query Frame = 1
BLAST of CU100383 vs. TrEMBL
Match: A0A067F365_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g039261mg PE=4 SV=1) HSP 1 Score: 172.9 bits (437), Expect = 3.6e-40 Identity = 73/98 (74.49%), Postives = 90/98 (91.84%), Query Frame = 1
BLAST of CU100383 vs. TrEMBL
Match: A0A0B0NMK4_GOSAR (Succinate dehydrogenase assembly factor 2, mitochondrial OS=Gossypium arboreum GN=F383_21595 PE=4 SV=1) HSP 1 Score: 172.2 bits (435), Expect = 6.2e-40 Identity = 73/98 (74.49%), Postives = 86/98 (87.76%), Query Frame = 1
BLAST of CU100383 vs. NCBI nr
Match: gi|449470271|ref|XP_004152841.1| (PREDICTED: succinate dehydrogenase assembly factor 2, mitochondrial [Cucumis sativus]) HSP 1 Score: 216.9 bits (551), Expect = 3.2e-53 Identity = 98/98 (100.00%), Postives = 98/98 (100.00%), Query Frame = 1
BLAST of CU100383 vs. NCBI nr
Match: gi|700206113|gb|KGN61232.1| (hypothetical protein Csa_2G072460 [Cucumis sativus]) HSP 1 Score: 216.9 bits (551), Expect = 3.2e-53 Identity = 98/98 (100.00%), Postives = 98/98 (100.00%), Query Frame = 1
BLAST of CU100383 vs. NCBI nr
Match: gi|659082578|ref|XP_008441916.1| (PREDICTED: uncharacterized protein LOC103485912 [Cucumis melo]) HSP 1 Score: 211.5 bits (537), Expect = 1.3e-51 Identity = 95/98 (96.94%), Postives = 97/98 (98.98%), Query Frame = 1
BLAST of CU100383 vs. NCBI nr
Match: gi|661898327|emb|CDO98294.1| (unnamed protein product [Coffea canephora]) HSP 1 Score: 176.0 bits (445), Expect = 6.2e-41 Identity = 74/98 (75.51%), Postives = 87/98 (88.78%), Query Frame = 1
BLAST of CU100383 vs. NCBI nr
Match: gi|641838702|gb|KDO57641.1| (hypothetical protein CISIN_1g039261mg [Citrus sinensis]) HSP 1 Score: 175.6 bits (444), Expect = 8.1e-41 Identity = 73/98 (74.49%), Postives = 90/98 (91.84%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|