CU100317 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GCTCGCTACAACAAGAAGCCGACTATTCTACCTTCTTCGGGTAGATCCAAACGGCGGTGCGCCTTGTTCTTCCTGGTGAGCTGGCTAAACACGCTGTCTCTGAGGGTACCAAGGCTGTTACCAAGTTCACTAGCTCTTAGATTCATAGATTTAGGGTTTTCTCGTGTAAAAAAGCAGGATCACTTGTTCTGGATCGTGGATTTTCTTTTCCTTTTGTTGCATATTTTTGGAATTGAATGAATGAAAATCGGTTTACATAACCCGAATTCTT
BLAST of CU100317 vs. Swiss-Prot
Match: H2B3_ARATH (Histone H2B.3 OS=Arabidopsis thaliana GN=At2g28720 PE=1 SV=3) HSP 1 Score: 61.6 bits (148), Expect = 5.0e-09 Identity = 31/31 (100.00%), Postives = 29/31 (93.55%), Query Frame = 3
BLAST of CU100317 vs. Swiss-Prot
Match: H2B6_ORYSJ (Histone H2B.6 OS=Oryza sativa subsp. japonica GN=H2B.6 PE=3 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 5.0e-09 Identity = 31/31 (100.00%), Postives = 29/31 (93.55%), Query Frame = 3
BLAST of CU100317 vs. Swiss-Prot
Match: H2B_GOSHI (Histone H2B OS=Gossypium hirsutum GN=HIS2B PE=2 SV=3) HSP 1 Score: 61.6 bits (148), Expect = 5.0e-09 Identity = 31/31 (100.00%), Postives = 29/31 (93.55%), Query Frame = 3
BLAST of CU100317 vs. Swiss-Prot
Match: H2B11_ARATH (Histone H2B.11 OS=Arabidopsis thaliana GN=At5g59910 PE=1 SV=5) HSP 1 Score: 61.6 bits (148), Expect = 5.0e-09 Identity = 31/31 (100.00%), Postives = 29/31 (93.55%), Query Frame = 3
BLAST of CU100317 vs. Swiss-Prot
Match: H2B_TOBAC (Histone H2B OS=Nicotiana tabacum GN=HIS2B PE=2 SV=3) HSP 1 Score: 61.6 bits (148), Expect = 5.0e-09 Identity = 31/31 (100.00%), Postives = 29/31 (93.55%), Query Frame = 3
BLAST of CU100317 vs. TrEMBL
Match: I3JKL4_ORENI (Histone H2B OS=Oreochromis niloticus GN=HIST1H2BA PE=3 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 1.9e-07 Identity = 31/39 (79.49%), Postives = 35/39 (89.74%), Query Frame = 3
BLAST of CU100317 vs. TrEMBL
Match: A0A0N4VGK6_ENTVE (Histone H4 OS=Enterobius vermicularis PE=3 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 2.5e-07 Identity = 32/47 (68.09%), Postives = 38/47 (80.85%), Query Frame = 3
BLAST of CU100317 vs. TrEMBL
Match: G3NDH3_GASAC (Histone H2B OS=Gasterosteus aculeatus GN=HIST1H2BA PE=3 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 4.2e-07 Identity = 32/40 (80.00%), Postives = 35/40 (87.50%), Query Frame = 3
BLAST of CU100317 vs. TrEMBL
Match: A0A0B2F0X3_9BACL (Uncharacterized protein (Fragment) OS=Paenibacillus sp. IHB B 3415 GN=QW71_36400 PE=4 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 5.5e-07 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 3
BLAST of CU100317 vs. TrEMBL
Match: A0A087GCC9_ARAAL (Histone H2B OS=Arabis alpina GN=AALP_AA8G395500 PE=3 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 5.5e-07 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 3
BLAST of CU100317 vs. NCBI nr
Match: gi|655846865|ref|XP_008262727.1| (PREDICTED: histone H2B type 2-F-like [Oryctolagus cuniculus]) HSP 1 Score: 65.9 bits (159), Expect = 4.2e-08 Identity = 33/40 (82.50%), Postives = 36/40 (90.00%), Query Frame = 3
BLAST of CU100317 vs. NCBI nr
Match: gi|913499544|ref|XP_013204527.1| (PREDICTED: uncharacterized protein LOC101998036 [Microtus ochrogaster]) HSP 1 Score: 65.5 bits (158), Expect = 5.5e-08 Identity = 34/52 (65.38%), Postives = 38/52 (73.08%), Query Frame = 3
BLAST of CU100317 vs. NCBI nr
Match: gi|602719525|ref|XP_007469932.1| (PREDICTED: IQ and AAA domain-containing protein 1-like [Lipotes vexillifer]) HSP 1 Score: 63.2 bits (152), Expect = 2.7e-07 Identity = 33/52 (63.46%), Postives = 36/52 (69.23%), Query Frame = 3
BLAST of CU100317 vs. NCBI nr
Match: gi|743701785|ref|XP_010944072.1| (PREDICTED: uncharacterized protein LOC105061668 [Camelus bactrianus]) HSP 1 Score: 63.2 bits (152), Expect = 2.7e-07 Identity = 31/40 (77.50%), Postives = 34/40 (85.00%), Query Frame = 3
BLAST of CU100317 vs. NCBI nr
Match: gi|609412460|pdb|4NFT|A (Chain A, Crystal Structure Of Human Lnkh2b-h2a.z-anp32e) HSP 1 Score: 63.2 bits (152), Expect = 2.7e-07 Identity = 36/56 (64.29%), Postives = 38/56 (67.86%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|