CU099372 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGAGTATAGGCGATGATAAGCTGAAACCAGAATAGGGACAGAAATAAACCAGTTGCCAAACACTAGAGATTTTCGAGTTTACAACAGAGCGAGCCCATTCGGAGTGTCTCCAGTTTCCAGCTCCGGTGAGAAAAATGCTGCAGTTCCCGGCTTTCATGACACAGTATCCTTGGTCTACCAGGAAAATTCCGACGTCGTTTTTACTGCCGTCTCAGTGGCCTCAACCCCAGAACGAAGAGCTACTGCTCGCCATGGAAGAAGCTGATTTTGAAGAAAAGTGCAATGAAATTAGGAAAACAAACAGCAACCTTGTGGTCATCGGAAAAATGACTGCTGACAATGATAAGGAAGACATTGAGGCAGAAGATGATGATGCTGACAATGCTGATTAATCTGAGGCTGAAGAATTTGAGCAGGAAACTGGCTAAAACTACTTGCATCTTTGTGCCCTTTCTTGCCTTTACTCTTTAAAATCCTCAAATTGCTAGTTTTTTTTAACGATTGTTCTTTGTAAATCTGTCACTTTGAAAAGCCAGAGTTTTTGTAATCGTTCAATTTGCTACTGTTATACTGTTTCCAATTTTACTTTCAATATGATGTTACAATTATGACATTGAAAGTTGAATGGTGTTACTAATGCTTGATCAGAAGAATTGTACTCAG
BLAST of CU099372 vs. TrEMBL
Match: A0A0A0LWF0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G046850 PE=4 SV=1) HSP 1 Score: 139.8 bits (351), Expect = 4.0e-30 Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 1
BLAST of CU099372 vs. TrEMBL
Match: A0A068UWH1_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00037364001 PE=4 SV=1) HSP 1 Score: 125.9 bits (315), Expect = 6.0e-26 Identity = 57/66 (86.36%), Postives = 64/66 (96.97%), Query Frame = 1
BLAST of CU099372 vs. TrEMBL
Match: A0A151TRI4_CAJCA (Uncharacterized protein OS=Cajanus cajan GN=KK1_008829 PE=4 SV=1) HSP 1 Score: 125.6 bits (314), Expect = 7.8e-26 Identity = 60/66 (90.91%), Postives = 62/66 (93.94%), Query Frame = 1
BLAST of CU099372 vs. TrEMBL
Match: I1KCB7_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_06G177900 PE=4 SV=1) HSP 1 Score: 125.2 bits (313), Expect = 1.0e-25 Identity = 59/66 (89.39%), Postives = 62/66 (93.94%), Query Frame = 1
BLAST of CU099372 vs. TrEMBL
Match: A0A0B2QDE0_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_012180 PE=4 SV=1) HSP 1 Score: 125.2 bits (313), Expect = 1.0e-25 Identity = 59/66 (89.39%), Postives = 62/66 (93.94%), Query Frame = 1
BLAST of CU099372 vs. NCBI nr
Match: gi|449469568|ref|XP_004152491.1| (PREDICTED: uncharacterized protein LOC101206898 [Cucumis sativus]) HSP 1 Score: 138.3 bits (347), Expect = 1.7e-29 Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 1
BLAST of CU099372 vs. NCBI nr
Match: gi|659067314|ref|XP_008438807.1| (PREDICTED: anaphase-promoting complex subunit 15 [Cucumis melo]) HSP 1 Score: 134.8 bits (338), Expect = 1.8e-28 Identity = 64/66 (96.97%), Postives = 65/66 (98.48%), Query Frame = 1
BLAST of CU099372 vs. NCBI nr
Match: gi|802650403|ref|XP_012079984.1| (PREDICTED: uncharacterized protein LOC105640311 [Jatropha curcas]) HSP 1 Score: 124.8 bits (312), Expect = 1.9e-25 Identity = 59/66 (89.39%), Postives = 62/66 (93.94%), Query Frame = 1
BLAST of CU099372 vs. NCBI nr
Match: gi|661883651|emb|CDP12736.1| (unnamed protein product [Coffea canephora]) HSP 1 Score: 124.4 bits (311), Expect = 2.5e-25 Identity = 57/66 (86.36%), Postives = 64/66 (96.97%), Query Frame = 1
BLAST of CU099372 vs. NCBI nr
Match: gi|1012358446|gb|KYP69630.1| (hypothetical protein KK1_008829 [Cajanus cajan]) HSP 1 Score: 124.0 bits (310), Expect = 3.3e-25 Identity = 60/66 (90.91%), Postives = 62/66 (93.94%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|