CU098163 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACTTACACGAAACTGGAGGACGAACCAGAAAACAACATTTTCATTTCAAATGTAATCAAACAAATGGATTCCGTAAAGTATAAAATTCAGTTCTTGAATATTACATATCTAACAGAATTCAGAAAGGATGGTCACCCTTCAAAGAATCGTGAGCCCGGCACACCTGATGACGCTCCACAAGATTGTAGTCACTGGTGCCTGCCTCGTGTTTAGAACTCTAGTTCCCATACACACAAATGCAAG
BLAST of CU098163 vs. Swiss-Prot
Match: TBL8_ARATH (Protein trichome birefringence-like 8 OS=Arabidopsis thaliana GN=TBL8 PE=2 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 6.7e-21 Identity = 44/67 (65.67%), Postives = 52/67 (77.61%), Query Frame = 1
BLAST of CU098163 vs. Swiss-Prot
Match: TBL9_ARATH (Protein trichome birefringence-like 9 OS=Arabidopsis thaliana GN=TBL9 PE=2 SV=1) HSP 1 Score: 87.4 bits (215), Expect = 7.7e-17 Identity = 41/67 (61.19%), Postives = 47/67 (70.15%), Query Frame = 1
BLAST of CU098163 vs. Swiss-Prot
Match: TBR_ARATH (Protein trichome birefringence OS=Arabidopsis thaliana GN=TBR PE=1 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 5.5e-07 Identity = 27/60 (45.00%), Postives = 34/60 (56.67%), Query Frame = 1
BLAST of CU098163 vs. Swiss-Prot
Match: TBL4_ARATH (Protein trichome birefringence-like 4 OS=Arabidopsis thaliana GN=TBL4 PE=3 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 9.4e-07 Identity = 28/65 (43.08%), Postives = 36/65 (55.38%), Query Frame = 1
BLAST of CU098163 vs. Swiss-Prot
Match: TBL5_ARATH (Protein trichome birefringence-like 5 OS=Arabidopsis thaliana GN=TBL5 PE=2 SV=1) HSP 1 Score: 52.0 bits (123), Expect = 3.6e-06 Identity = 29/76 (38.16%), Postives = 37/76 (48.68%), Query Frame = 1
BLAST of CU098163 vs. TrEMBL
Match: A0A0A0KHJ0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G454320 PE=4 SV=1) HSP 1 Score: 149.1 bits (375), Expect = 2.4e-33 Identity = 68/69 (98.55%), Postives = 68/69 (98.55%), Query Frame = 1
BLAST of CU098163 vs. TrEMBL
Match: A0A061EUN4_THECC (Trichome birefringence-like 8, putative OS=Theobroma cacao GN=TCM_022720 PE=4 SV=1) HSP 1 Score: 112.5 bits (280), Expect = 2.5e-22 Identity = 50/70 (71.43%), Postives = 59/70 (84.29%), Query Frame = 1
BLAST of CU098163 vs. TrEMBL
Match: V4UUM4_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10013764mg PE=4 SV=1) HSP 1 Score: 111.7 bits (278), Expect = 4.2e-22 Identity = 51/69 (73.91%), Postives = 56/69 (81.16%), Query Frame = 1
BLAST of CU098163 vs. TrEMBL
Match: V7BJV5_PHAVU (Uncharacterized protein (Fragment) OS=Phaseolus vulgaris GN=PHAVU_007G230600g PE=4 SV=1) HSP 1 Score: 111.3 bits (277), Expect = 5.5e-22 Identity = 51/68 (75.00%), Postives = 55/68 (80.88%), Query Frame = 1
BLAST of CU098163 vs. TrEMBL
Match: K7LHY5_SOYBN (Uncharacterized protein OS=Glycine max PE=4 SV=1) HSP 1 Score: 110.2 bits (274), Expect = 1.2e-21 Identity = 50/68 (73.53%), Postives = 54/68 (79.41%), Query Frame = 1
BLAST of CU098163 vs. NCBI nr
Match: gi|449451281|ref|XP_004143390.1| (PREDICTED: protein trichome birefringence-like 8 [Cucumis sativus]) HSP 1 Score: 148.7 bits (374), Expect = 4.5e-33 Identity = 68/69 (98.55%), Postives = 68/69 (98.55%), Query Frame = 1
BLAST of CU098163 vs. NCBI nr
Match: gi|700193080|gb|KGN48284.1| (hypothetical protein Csa_6G454320 [Cucumis sativus]) HSP 1 Score: 148.7 bits (374), Expect = 4.5e-33 Identity = 68/69 (98.55%), Postives = 68/69 (98.55%), Query Frame = 1
BLAST of CU098163 vs. NCBI nr
Match: gi|659125270|ref|XP_008462600.1| (PREDICTED: protein trichome birefringence-like 8 [Cucumis melo]) HSP 1 Score: 145.6 bits (366), Expect = 3.8e-32 Identity = 66/69 (95.65%), Postives = 68/69 (98.55%), Query Frame = 1
BLAST of CU098163 vs. NCBI nr
Match: gi|697133189|ref|XP_009620645.1| (PREDICTED: protein trichome birefringence-like 8 isoform X2 [Nicotiana tomentosiformis]) HSP 1 Score: 116.7 bits (291), Expect = 1.9e-23 Identity = 52/69 (75.36%), Postives = 59/69 (85.51%), Query Frame = 1
BLAST of CU098163 vs. NCBI nr
Match: gi|697133187|ref|XP_009620644.1| (PREDICTED: protein trichome birefringence-like 8 isoform X1 [Nicotiana tomentosiformis]) HSP 1 Score: 116.7 bits (291), Expect = 1.9e-23 Identity = 52/69 (75.36%), Postives = 59/69 (85.51%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|