CU098002 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TAGTTGGTCCTATGGGGATTATGAACAGTTTTATTAACGACATTTTTTGAGAAGCTTGCTCAGGAATCGTCGCGATTGGCTAGGTATAACAAGAAGCCGACTATCACCTCTAGGGAAATCCAAACGGCTGTTCGGCTTGTGCTTCCTGGTGAACTTGCCAAGCATGCTGTATCGGAAGGGACGAAAGCAGTTACTAAATTCACCAGTTCTTAGAAATTTCGATCGTATCTGTTAGTGTTTAGAAATTAGTTTTGATAGTGTGTGATGACATAGATTGCGATAGCTTTTGTCTGGCTTAGTATGAAACTGAAATTCTTTGTTTTAAATTTGATGCTTTCTTTTCGTATAATTGTAGATCAGTAATCAGAAAGTGTTTAGAATTCGTCGTTTGTTCCTACTTTTTTCTTTTATTCTAATTGAATAGAACACTTGGGAAGAGAATTCTTGATACG
BLAST of CU098002 vs. Swiss-Prot
Match: H2B_CAPAN (Histone H2B OS=Capsicum annuum GN=HIS2B PE=2 SV=3) HSP 1 Score: 107.1 bits (266), Expect = 1.7e-22 Identity = 55/55 (100.00%), Postives = 53/55 (96.36%), Query Frame = 1
BLAST of CU098002 vs. Swiss-Prot
Match: H2B1_MEDTR (Probable histone H2B.1 OS=Medicago truncatula PE=3 SV=3) HSP 1 Score: 107.1 bits (266), Expect = 1.7e-22 Identity = 55/55 (100.00%), Postives = 53/55 (96.36%), Query Frame = 1
BLAST of CU098002 vs. Swiss-Prot
Match: H2B3_MEDTR (Probable histone H2B.3 OS=Medicago truncatula PE=3 SV=3) HSP 1 Score: 107.1 bits (266), Expect = 1.7e-22 Identity = 55/55 (100.00%), Postives = 53/55 (96.36%), Query Frame = 1
BLAST of CU098002 vs. Swiss-Prot
Match: H2B9_ARATH (Histone H2B.9 OS=Arabidopsis thaliana GN=At5g02570 PE=1 SV=3) HSP 1 Score: 107.1 bits (266), Expect = 1.7e-22 Identity = 55/55 (100.00%), Postives = 53/55 (96.36%), Query Frame = 1
BLAST of CU098002 vs. Swiss-Prot
Match: H2B3_SOLLC (Histone H2B.3 (Fragment) OS=Solanum lycopersicum GN=H2B-3 PE=2 SV=1) HSP 1 Score: 105.9 bits (263), Expect = 3.9e-22 Identity = 54/55 (98.18%), Postives = 53/55 (96.36%), Query Frame = 1
BLAST of CU098002 vs. TrEMBL
Match: A0A151SAQ0_CAJCA (Histone H2B (Fragment) OS=Cajanus cajan GN=KK1_026330 PE=3 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 3.9e-21 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = 1
BLAST of CU098002 vs. TrEMBL
Match: A0A0S3SLF1_PHAAN (Histone H2B OS=Vigna angularis var. angularis GN=Vigan.08G020000 PE=3 SV=1) HSP 1 Score: 107.1 bits (266), Expect = 1.9e-20 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 1
BLAST of CU098002 vs. TrEMBL
Match: I3S6P0_LOTJA (Histone H2B OS=Lotus japonicus PE=2 SV=1) HSP 1 Score: 107.1 bits (266), Expect = 1.9e-20 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 1
BLAST of CU098002 vs. TrEMBL
Match: I3T995_LOTJA (Histone H2B OS=Lotus japonicus PE=2 SV=1) HSP 1 Score: 107.1 bits (266), Expect = 1.9e-20 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 1
BLAST of CU098002 vs. TrEMBL
Match: I3SY24_LOTJA (Histone H2B OS=Lotus japonicus PE=2 SV=1) HSP 1 Score: 107.1 bits (266), Expect = 1.9e-20 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 1
BLAST of CU098002 vs. NCBI nr
Match: gi|1012340595|gb|KYP51809.1| (Histone H2B, partial [Cajanus cajan]) HSP 1 Score: 109.4 bits (272), Expect = 5.6e-21 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = 1
BLAST of CU098002 vs. NCBI nr
Match: gi|151564660|gb|ABS17661.1| (histone H2B, partial [Arnebia euchroma]) HSP 1 Score: 107.1 bits (266), Expect = 2.8e-20 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 1
BLAST of CU098002 vs. NCBI nr
Match: gi|922369492|ref|XP_013456910.1| (core histone H2A/H2B/H3/H4 [Medicago truncatula]) HSP 1 Score: 107.1 bits (266), Expect = 2.8e-20 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 1
BLAST of CU098002 vs. NCBI nr
Match: gi|7387727|sp|O49118.3|H2B_CAPAN (RecName: Full=Histone H2B; AltName: Full=CaH2B) HSP 1 Score: 107.1 bits (266), Expect = 2.8e-20 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 1
BLAST of CU098002 vs. NCBI nr
Match: gi|565453926|ref|XP_006286660.1| (hypothetical protein CARUB_v10002579mg [Capsella rubella]) HSP 1 Score: 107.1 bits (266), Expect = 2.8e-20 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|