CU097641 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGACAACACAAATCAAATTCGCATCTTTCCATCCTTTCCTTAAAAACATCTTTGCTTAGCTTCCTAATTCATTTTTTTTTAAAAAAAATGGTGTCTAAAGTGGAAGAAACACTGAGAAGGAAGTACCAGCAAGTTCATCCGCCGCAGACGGCGGTGGCAGCAGTGGCAGCGGCGGCAACGGCAAAGCAAATCCAATGCAATAAAGCCAAATATCCCAAGTTCAAGAGAAGTAGCTCCAATGTTGAAGAAGATGGCGCCTCTTCCGCCATGCTTTTGCTTGCTTGCATTGCTTTTGCCTCTTAATTTTTAGCCACGGAGCCGTCATTCGAGATTTATGGAGGAGGGATTAGCTGTTGTTCTCTTGACGCCGGTCGTCGGAGGCCACTTCCGGTAGCTAATTATGAGTACATAAATATTAATGGTCGTCGTAGTTTTTCTCTGATTTAGAAGTGATTATTAGATCGATAAGATATATATATTCTTTATTTCTATTTTTATTTTCCCTTAATTCGTTTTTTCTTTTTCGCGTTATTAATTTTGTACTCTTTGAAAATTATTTCTTAGTATAAATATATTTTGTTTTCTAGTCCT
BLAST of CU097641 vs. TrEMBL
Match: A0A0A0LTS0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G050230 PE=4 SV=1) HSP 1 Score: 115.2 bits (287), Expect = 9.4e-23 Identity = 59/71 (83.10%), Postives = 59/71 (83.10%), Query Frame = 2
BLAST of CU097641 vs. TrEMBL
Match: A0A061FZA4_THECC (Uncharacterized protein OS=Theobroma cacao GN=TCM_014581 PE=4 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 1.7e-11 Identity = 41/68 (60.29%), Postives = 46/68 (67.65%), Query Frame = 2
BLAST of CU097641 vs. TrEMBL
Match: A0A151TE32_CAJCA (Uncharacterized protein OS=Cajanus cajan GN=KK1_011552 PE=4 SV=1) HSP 1 Score: 72.0 bits (175), Expect = 9.1e-10 Identity = 42/70 (60.00%), Postives = 46/70 (65.71%), Query Frame = 2
BLAST of CU097641 vs. TrEMBL
Match: A0A0B2RRF8_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_016720 PE=4 SV=1) HSP 1 Score: 72.0 bits (175), Expect = 9.1e-10 Identity = 41/70 (58.57%), Postives = 46/70 (65.71%), Query Frame = 2
BLAST of CU097641 vs. TrEMBL
Match: I1K083_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_05G0454002 PE=4 SV=1) HSP 1 Score: 72.0 bits (175), Expect = 9.1e-10 Identity = 41/70 (58.57%), Postives = 46/70 (65.71%), Query Frame = 2
BLAST of CU097641 vs. NCBI nr
Match: gi|700209288|gb|KGN64384.1| (hypothetical protein Csa_1G050230 [Cucumis sativus]) HSP 1 Score: 113.2 bits (282), Expect = 5.1e-22 Identity = 59/71 (83.10%), Postives = 59/71 (83.10%), Query Frame = 2
BLAST of CU097641 vs. NCBI nr
Match: gi|659067431|ref|XP_008439407.1| (PREDICTED: uncharacterized protein LOC103484223 [Cucumis melo]) HSP 1 Score: 103.2 bits (256), Expect = 5.3e-19 Identity = 57/74 (77.03%), Postives = 57/74 (77.03%), Query Frame = 2
BLAST of CU097641 vs. NCBI nr
Match: gi|590669889|ref|XP_007037902.1| (Uncharacterized protein TCM_014581 [Theobroma cacao]) HSP 1 Score: 76.3 bits (186), Expect = 6.9e-11 Identity = 41/68 (60.29%), Postives = 46/68 (67.65%), Query Frame = 2
BLAST of CU097641 vs. NCBI nr
Match: gi|645268204|ref|XP_008239421.1| (PREDICTED: uncharacterized protein LOC103338021 [Prunus mume]) HSP 1 Score: 70.1 bits (170), Expect = 5.0e-09 Identity = 40/70 (57.14%), Postives = 48/70 (68.57%), Query Frame = 2
BLAST of CU097641 vs. NCBI nr
Match: gi|1012354132|gb|KYP65319.1| (hypothetical protein KK1_011552 [Cajanus cajan]) HSP 1 Score: 70.1 bits (170), Expect = 5.0e-09 Identity = 42/70 (60.00%), Postives = 46/70 (65.71%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|