CU097557 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGAGCAGATTAGATCCGGAGATTCGAAAATTCTTCGTTCTTCGTCCTAATTTCCCCCATCGCCATTTTCGCAGCTTCGAAGTCAACCTGCAGGCTGCAATTTTATAATTATTGGCGTTGCTGCTTACCTGAGCTTTTCTAGTTAATCATGTCTGAGCATATCAAAGAGGCCGAACGAGTGGGTGGAGATGGACATGTTGGATCTGAAGAATCTATGTCGTCATCTCGTAAAGAGGAGGAAGTTATAAGAAAAATATGGAGGAATTGTTCCCAAGAAGCCACCACTCATTTCTAAGGATCATGAACGTGCTTATTTTGATTCTGCTGATTGGGCATTGGGAAAGCAAGGAGTTGAGAAGCCGAAAGGACCTTTAGAAGCTCTTCGGCCGAAAATTACAGCCAACACAACAGCAAAACACGGTACAGGAAGTCTCCTTGTGCTCCATCAGATGGCGAAGATGGGCG
BLAST of CU097557 vs. TrEMBL
Match: B9TEW9_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_1925410 PE=4 SV=1) HSP 1 Score: 104.4 bits (259), Expect = 1.3e-19 Identity = 48/59 (81.36%), Postives = 52/59 (88.14%), Query Frame = 1
BLAST of CU097557 vs. TrEMBL
Match: A0A067FAM4_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g033401mg PE=4 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 1.7e-19 Identity = 48/51 (94.12%), Postives = 50/51 (98.04%), Query Frame = 1
BLAST of CU097557 vs. TrEMBL
Match: A0A067FAM4_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g033401mg PE=4 SV=1) HSP 1 Score: 32.0 bits (71), Expect = 8.2e+02 Identity = 13/17 (76.47%), Postives = 15/17 (88.24%), Query Frame = 3
HSP 2 Score: 104.0 bits (258), Expect = 1.7e-19 Identity = 48/51 (94.12%), Postives = 50/51 (98.04%), Query Frame = 1
BLAST of CU097557 vs. TrEMBL
Match: V4SXY0_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10013128mg PE=4 SV=1) HSP 1 Score: 32.0 bits (71), Expect = 8.2e+02 Identity = 13/17 (76.47%), Postives = 15/17 (88.24%), Query Frame = 3
HSP 2 Score: 104.0 bits (258), Expect = 1.7e-19 Identity = 48/51 (94.12%), Postives = 50/51 (98.04%), Query Frame = 1
BLAST of CU097557 vs. TrEMBL
Match: A0A161WTG9_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_010729 PE=4 SV=1) HSP 1 Score: 103.6 bits (257), Expect = 2.2e-19 Identity = 47/60 (78.33%), Postives = 52/60 (86.67%), Query Frame = 1
BLAST of CU097557 vs. NCBI nr
Match: gi|645245935|ref|XP_008229118.1| (PREDICTED: uncharacterized protein LOC103328500 isoform X1 [Prunus mume]) HSP 1 Score: 120.6 bits (301), Expect = 2.5e-24 Identity = 57/73 (78.08%), Postives = 65/73 (89.04%), Query Frame = 1
BLAST of CU097557 vs. NCBI nr
Match: gi|223518543|gb|EEF25595.1| (conserved hypothetical protein [Ricinus communis]) HSP 1 Score: 106.3 bits (264), Expect = 4.9e-20 Identity = 48/59 (81.36%), Postives = 52/59 (88.14%), Query Frame = 1
BLAST of CU097557 vs. NCBI nr
Match: gi|567876181|ref|XP_006430680.1| (hypothetical protein CICLE_v10013128mg [Citrus clementina]) HSP 1 Score: 105.9 bits (263), Expect = 6.5e-20 Identity = 48/51 (94.12%), Postives = 50/51 (98.04%), Query Frame = 1
BLAST of CU097557 vs. NCBI nr
Match: gi|641844273|gb|KDO63167.1| (hypothetical protein CISIN_1g033401mg [Citrus sinensis]) HSP 1 Score: 105.9 bits (263), Expect = 6.5e-20 Identity = 48/51 (94.12%), Postives = 50/51 (98.04%), Query Frame = 1
BLAST of CU097557 vs. NCBI nr
Match: gi|568857239|ref|XP_006482174.1| (PREDICTED: ribosome biogenesis protein erb1 isoform X2 [Citrus sinensis]) HSP 1 Score: 105.9 bits (263), Expect = 6.5e-20 Identity = 48/51 (94.12%), Postives = 50/51 (98.04%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|