CU097441 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GCCTCGCCCTCCTCAACAATGCTGGACTTAGACTGCTTGTTTCATATTCCTCTTATCCTCCTCTATAATGCGGATCGGGGTACATGTCCGGAGATATTGACAAGGGGATTTCTGAGAGTAACATAGGCCTTCTTGTAATCAGGCTTTGCGATCAAGATCCCTCCACGCTTCTTTTTCTTCCCCTCCAATAGTTAAGAGTTTGAACTTTATCGACCTCAAAGCCGTAAAGGCTCTCAAGGACGCGCTTGATTTCAATTTTGGAAGCAGAAGGAATGGTTTTAAGAGCAATTTCAGTGATGTTGGTAAAAGAGGTAGGCATAAGAAGCTTGATTGGAAGATTTGCGAAGTGAACAACTCTTCTCCCGAGTCTGCTTCCCATGTTCCTGGATTTCTTGGCTTCCGCGTCTATGAACAGCAGGTGAAGAGATCCTGTGGATTGTAGATTTGTACTCGCAAGCTTTCAGCGAACTGAAGGGATTTGGGACCGAACGGCGAGGTGCACTGCTGGGACTATTAGGCCTTCTGCTGGGATAATAGCGGTCGTAGACCCCCGGCCG
BLAST of CU097441 vs. TrEMBL
Match: A0A0A0L0J2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G095560 PE=4 SV=1) HSP 1 Score: 138.3 bits (347), Expect = 9.6e-30 Identity = 76/101 (75.25%), Postives = 81/101 (80.20%), Query Frame = -2
BLAST of CU097441 vs. TrEMBL
Match: A0A0A0L0J2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G095560 PE=4 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 2.8e-05 Identity = 34/52 (65.38%), Postives = 36/52 (69.23%), Query Frame = -1
HSP 2 Score: 134.0 bits (336), Expect = 1.8e-28 Identity = 72/101 (71.29%), Postives = 81/101 (80.20%), Query Frame = -2
BLAST of CU097441 vs. TrEMBL
Match: A0A059AL68_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_I00432 PE=4 SV=1) HSP 1 Score: 46.6 bits (109), Expect = 3.8e-02 Identity = 27/52 (51.92%), Postives = 36/52 (69.23%), Query Frame = -1
HSP 2 Score: 129.0 bits (323), Expect = 5.9e-27 Identity = 70/101 (69.31%), Postives = 80/101 (79.21%), Query Frame = -2
BLAST of CU097441 vs. TrEMBL
Match: A0A067LED8_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_24040 PE=4 SV=1) HSP 1 Score: 50.8 bits (120), Expect = 2.0e-03 Identity = 29/52 (55.77%), Postives = 37/52 (71.15%), Query Frame = -1
HSP 2 Score: 128.3 bits (321), Expect = 1.0e-26 Identity = 70/101 (69.31%), Postives = 81/101 (80.20%), Query Frame = -2
BLAST of CU097441 vs. TrEMBL
Match: A0A124SC01_CYNCS (Nucleotide-binding, alpha-beta plait OS=Cynara cardunculus var. scolymus GN=Ccrd_005742 PE=4 SV=1) HSP 1 Score: 48.9 bits (115), Expect = 7.7e-03 Identity = 31/52 (59.62%), Postives = 36/52 (69.23%), Query Frame = -1
HSP 2 Score: 128.3 bits (321), Expect = 1.0e-26 Identity = 70/101 (69.31%), Postives = 81/101 (80.20%), Query Frame = -2
BLAST of CU097441 vs. NCBI nr
Match: gi|449438835|ref|XP_004137193.1| (PREDICTED: uncharacterized protein LOC101221365 [Cucumis sativus]) HSP 1 Score: 138.7 bits (348), Expect = 1.1e-29 Identity = 76/101 (75.25%), Postives = 81/101 (80.20%), Query Frame = -2
BLAST of CU097441 vs. NCBI nr
Match: gi|702459884|ref|XP_010027851.1| (PREDICTED: uncharacterized protein LOC104418266 [Eucalyptus grandis]) HSP 1 Score: 134.4 bits (337), Expect = 2.0e-28 Identity = 72/101 (71.29%), Postives = 81/101 (80.20%), Query Frame = -2
BLAST of CU097441 vs. NCBI nr
Match: gi|659111130|ref|XP_008455593.1| (PREDICTED: 50S ribosomal protein L23, chloroplastic [Cucumis melo]) HSP 1 Score: 132.9 bits (333), Expect = 5.8e-28 Identity = 73/101 (72.28%), Postives = 80/101 (79.21%), Query Frame = -2
BLAST of CU097441 vs. NCBI nr
Match: gi|802537059|ref|XP_012090274.1| (PREDICTED: uncharacterized protein LOC105648393 isoform X2 [Jatropha curcas]) HSP 1 Score: 129.8 bits (325), Expect = 4.9e-27 Identity = 70/101 (69.31%), Postives = 81/101 (80.20%), Query Frame = -2
BLAST of CU097441 vs. NCBI nr
Match: gi|694420378|ref|XP_009338103.1| (PREDICTED: uncharacterized protein LOC103930484 [Pyrus x bretschneideri]) HSP 1 Score: 129.8 bits (325), Expect = 4.9e-27 Identity = 68/101 (67.33%), Postives = 81/101 (80.20%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|