CU096939 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTTAATAAATAAAAATAGATGGTCGATGTTGATTCATATTGATCTAATCAAGTAATGGAGGTCCACACAATTCTAATTGATGTAATCTTAAAATGATGTTTATCAATCGTATTAAACTATAGATGGGGCAAACATGCTTTAGTTTCAAGTCTTCTTTGTTGTTACAAAGAACCTTCTTCATTATATGGCAATTTGCAGGGGGCCAAACGGTCTTTAGATTTATATTGCCCAAGCACTTCAGAAACTGTTCTACAACGACATTGGTTCCCTGGCCGGATTACATCTCCGTAAACAGCCATTTCAATTATGTCAAGCTCCTTATCAGTAAACTTGACATCACACGAATAGCCTTTCAACTCAGACGTATCAACATCGTCTTTGTTCGATTTGAATCTGTTTACTCTCGTC
BLAST of CU096939 vs. TrEMBL
Match: A0A0A0LUK3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G011480 PE=4 SV=1) HSP 1 Score: 170.2 bits (430), Expect = 1.7e-39 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = -2
BLAST of CU096939 vs. TrEMBL
Match: D7SI72_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_17s0000g06660 PE=4 SV=1) HSP 1 Score: 144.1 bits (362), Expect = 1.3e-31 Identity = 65/78 (83.33%), Postives = 75/78 (96.15%), Query Frame = -2
BLAST of CU096939 vs. TrEMBL
Match: A0A0V0H5P5_SOLCH (Putative ovule protein (Fragment) OS=Solanum chacoense PE=4 SV=1) HSP 1 Score: 142.9 bits (359), Expect = 2.9e-31 Identity = 64/78 (82.05%), Postives = 71/78 (91.03%), Query Frame = -2
BLAST of CU096939 vs. TrEMBL
Match: M1B7E4_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400015000 PE=4 SV=1) HSP 1 Score: 142.1 bits (357), Expect = 4.9e-31 Identity = 64/78 (82.05%), Postives = 70/78 (89.74%), Query Frame = -2
BLAST of CU096939 vs. TrEMBL
Match: A0A0D2TTQ0_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_008G195700 PE=4 SV=1) HSP 1 Score: 141.7 bits (356), Expect = 6.4e-31 Identity = 64/78 (82.05%), Postives = 74/78 (94.87%), Query Frame = -2
BLAST of CU096939 vs. NCBI nr
Match: gi|449440818|ref|XP_004138181.1| (PREDICTED: uncharacterized protein LOC101204599 isoform X2 [Cucumis sativus]) HSP 1 Score: 171.4 bits (433), Expect = 1.1e-39 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = -2
BLAST of CU096939 vs. NCBI nr
Match: gi|700208600|gb|KGN63696.1| (hypothetical protein Csa_1G011480 [Cucumis sativus]) HSP 1 Score: 171.4 bits (433), Expect = 1.1e-39 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = -2
BLAST of CU096939 vs. NCBI nr
Match: gi|778655999|ref|XP_011660190.1| (PREDICTED: uncharacterized protein LOC101204599 isoform X1 [Cucumis sativus]) HSP 1 Score: 165.6 bits (418), Expect = 6.0e-38 Identity = 81/85 (95.29%), Postives = 81/85 (95.29%), Query Frame = -2
BLAST of CU096939 vs. NCBI nr
Match: gi|659105999|ref|XP_008453224.1| (PREDICTED: uncharacterized protein LOC103494011 isoform X2 [Cucumis melo]) HSP 1 Score: 163.3 bits (412), Expect = 3.0e-37 Identity = 76/78 (97.44%), Postives = 78/78 (100.00%), Query Frame = -2
BLAST of CU096939 vs. NCBI nr
Match: gi|659105995|ref|XP_008453223.1| (PREDICTED: uncharacterized protein LOC103494011 isoform X1 [Cucumis melo]) HSP 1 Score: 157.5 bits (397), Expect = 1.6e-35 Identity = 76/82 (92.68%), Postives = 78/82 (95.12%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|