|
The following sequences are available for this feature:
transcribed_cluster sequence GAGCGTCACTACGCCCCTGGTGGCCGAGGAAGGGGTCGTGGACGTGGTTCAAGGGGAGGATACAGTGGCAGCCCGATGAGCAATGTTGCAGCCCCATCCATTGGAGACCCTGGGCAGTTCCCAACCTTAGGTGCGAAGTAAATTTCGCAAATAAATTTTCCCTTACAAAACTGTGTTTTTGATCTGGGGCAGGAAACTGACTAGAATAATATAGTCTCTCCTGTATCAAAATGATTTTTAAGTTTAATTTGTTTAGGTGTAAATTGTCAAAGTCCTTGTATTTTCCCTTGTCCACCTTTCTTTGTGTGTTTTCAACTGTTGTTTCAAGACTGTTTGCCAGATCAAACTGTTTATTTATGGACTTCCTTCTTCCCCATCAAT
The following BLAST results are available for this feature:
Match Name | E-value | Identity | Description | |
The following terms have been associated with this transcribed_cluster:
Vocabulary: INTERPRO
Term | Definition |
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
IPR Term | IPR Description | Source | Source Term | Source Description | Alignment |
None | No IPR available | PANTHER | PTHR12299 | HYALURONIC ACID-BINDING PROTEIN 4 | coord: 1..46 score: 5.5 |
None | No IPR available | PANTHER | PTHR12299:SF24 | SUBFAMILY NOT NAMED | coord: 1..46 score: 5.5 |
|