CU095393 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGAGGGGAACGGACAACAACCCATCTTGGGGATATACATAGCCTGCTCGAGAATAAGAGCAGTGATTTGAAAATATAGACAAAAAGAAGGGAGAGGTAGAAGATGGCTGGGATGATGTTTACCATGCTGCTTTGCCTCTCGGCTGCAGGAATGATGGCGACGGTCCGTGGTGAAGACCCTTATTTCTTCTTCACATGGAATGTCACCTATGGCACCATCTCTCCCTTGGGCGTTCCCCAACAAGGCATTCTCATCAATGGTCAATTCCCCGGACCTAATATAACTCCAC
BLAST of CU095393 vs. Swiss-Prot
Match: ASOL_TOBAC (L-ascorbate oxidase homolog OS=Nicotiana tabacum PE=2 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 8.5e-15 Identity = 38/53 (71.70%), Postives = 39/53 (73.58%), Query Frame = 1
BLAST of CU095393 vs. Swiss-Prot
Match: ASOL_BRANA (L-ascorbate oxidase homolog OS=Brassica napus GN=Bp10 PE=2 SV=1) HSP 1 Score: 77.0 bits (188), Expect = 1.2e-13 Identity = 37/60 (61.67%), Postives = 36/60 (60.00%), Query Frame = 1
BLAST of CU095393 vs. Swiss-Prot
Match: SKU5_ARATH (Monocopper oxidase-like protein SKU5 OS=Arabidopsis thaliana GN=SKU5 PE=1 SV=1) HSP 1 Score: 54.3 bits (129), Expect = 8.5e-07 Identity = 24/36 (66.67%), Postives = 26/36 (72.22%), Query Frame = 1
BLAST of CU095393 vs. Swiss-Prot
Match: SKS1_ARATH (Monocopper oxidase-like protein SKS1 OS=Arabidopsis thaliana GN=SKS1 PE=1 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 5.5e-06 Identity = 25/55 (45.45%), Postives = 33/55 (60.00%), Query Frame = 1
BLAST of CU095393 vs. TrEMBL
Match: A0A0A0KYZ3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G267440 PE=4 SV=1) HSP 1 Score: 128.6 bits (322), Expect = 4.0e-27 Identity = 59/60 (98.33%), Postives = 60/60 (100.00%), Query Frame = 1
BLAST of CU095393 vs. TrEMBL
Match: A0A0A0KYZ5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G267980 PE=4 SV=1) HSP 1 Score: 119.4 bits (298), Expect = 2.4e-24 Identity = 55/60 (91.67%), Postives = 56/60 (93.33%), Query Frame = 1
BLAST of CU095393 vs. TrEMBL
Match: A0A0A0KWZ0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G267480 PE=4 SV=1) HSP 1 Score: 115.5 bits (288), Expect = 3.5e-23 Identity = 54/60 (90.00%), Postives = 55/60 (91.67%), Query Frame = 1
BLAST of CU095393 vs. TrEMBL
Match: A0A0A0L0B1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G267470 PE=4 SV=1) HSP 1 Score: 111.3 bits (277), Expect = 6.6e-22 Identity = 53/60 (88.33%), Postives = 56/60 (93.33%), Query Frame = 1
BLAST of CU095393 vs. TrEMBL
Match: A0A0A0LQ79_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G031720 PE=4 SV=1) HSP 1 Score: 105.1 bits (261), Expect = 4.7e-20 Identity = 47/60 (78.33%), Postives = 52/60 (86.67%), Query Frame = 1
BLAST of CU095393 vs. NCBI nr
Match: gi|778692720|ref|XP_011653513.1| (PREDICTED: L-ascorbate oxidase homolog [Cucumis sativus]) HSP 1 Score: 129.8 bits (325), Expect = 2.6e-27 Identity = 59/60 (98.33%), Postives = 60/60 (100.00%), Query Frame = 1
BLAST of CU095393 vs. NCBI nr
Match: gi|700198851|gb|KGN54009.1| (hypothetical protein Csa_4G267440 [Cucumis sativus]) HSP 1 Score: 129.8 bits (325), Expect = 2.6e-27 Identity = 59/60 (98.33%), Postives = 60/60 (100.00%), Query Frame = 1
BLAST of CU095393 vs. NCBI nr
Match: gi|700198856|gb|KGN54014.1| (hypothetical protein Csa_4G267980 [Cucumis sativus]) HSP 1 Score: 120.6 bits (301), Expect = 1.5e-24 Identity = 55/60 (91.67%), Postives = 56/60 (93.33%), Query Frame = 1
BLAST of CU095393 vs. NCBI nr
Match: gi|659098052|ref|XP_008449954.1| (PREDICTED: L-ascorbate oxidase homolog [Cucumis melo]) HSP 1 Score: 118.2 bits (295), Expect = 7.7e-24 Identity = 54/60 (90.00%), Postives = 55/60 (91.67%), Query Frame = 1
BLAST of CU095393 vs. NCBI nr
Match: gi|700198855|gb|KGN54013.1| (hypothetical protein Csa_4G267480 [Cucumis sativus]) HSP 1 Score: 116.7 bits (291), Expect = 2.2e-23 Identity = 54/60 (90.00%), Postives = 55/60 (91.67%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|