CU095018 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGAACCAATACTGGAAAGATTTGGAGAACGGGAACTCGATAGAAGCATGGGCGAGTAAGTGGGAAATGCACGGAACTTGCTCCGCGGCTGGGTTTGATCAGTTCAAGTATTTCTGCTTGGGTCTGGATACCTACGGTCGCCATGCCATTTTTTCATTTCTAGACCGTGAAGGATTGGCTCCCAGCTCTAGCAAGTATGTAGCCAAGGCTAGCTTTATCACAGCCATCGCAAACTCGACCTTGAAGAAGGGTGG
BLAST of CU095018 vs. TrEMBL
Match: A0A0A0K4L1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G351900 PE=3 SV=1) HSP 1 Score: 177.2 bits (448), Expect = 8.7e-42 Identity = 83/83 (100.00%), Postives = 83/83 (100.00%), Query Frame = 2
BLAST of CU095018 vs. TrEMBL
Match: A0A0A0LDS5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G743990 PE=3 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 2.0e-06 Identity = 26/66 (39.39%), Postives = 41/66 (62.12%), Query Frame = 2
BLAST of CU095018 vs. TrEMBL
Match: Q6DFA3_XENLA (Rnaset2-prov protein OS=Xenopus laevis GN=rnaset2 PE=2 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 2.6e-06 Identity = 28/71 (39.44%), Postives = 42/71 (59.15%), Query Frame = 2
BLAST of CU095018 vs. TrEMBL
Match: K7KG07_SOYBN (Uncharacterized protein OS=Glycine max PE=3 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 7.7e-06 Identity = 27/72 (37.50%), Postives = 36/72 (50.00%), Query Frame = 2
BLAST of CU095018 vs. TrEMBL
Match: A0A0R0KLN7_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_03G194500 PE=3 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 7.7e-06 Identity = 27/72 (37.50%), Postives = 36/72 (50.00%), Query Frame = 2
BLAST of CU095018 vs. NCBI nr
Match: gi|778727014|ref|XP_004149779.2| (PREDICTED: ribonuclease MC-like [Cucumis sativus]) HSP 1 Score: 176.8 bits (447), Expect = 1.6e-41 Identity = 84/85 (98.82%), Postives = 84/85 (98.82%), Query Frame = 2
BLAST of CU095018 vs. NCBI nr
Match: gi|700189392|gb|KGN44625.1| (hypothetical protein Csa_7G351900 [Cucumis sativus]) HSP 1 Score: 176.0 bits (445), Expect = 2.8e-41 Identity = 83/83 (100.00%), Postives = 83/83 (100.00%), Query Frame = 2
BLAST of CU095018 vs. NCBI nr
Match: gi|700203881|gb|KGN59014.1| (hypothetical protein Csa_3G743990 [Cucumis sativus]) HSP 1 Score: 59.7 bits (143), Expect = 2.9e-06 Identity = 26/66 (39.39%), Postives = 41/66 (62.12%), Query Frame = 2
BLAST of CU095018 vs. NCBI nr
Match: gi|148223095|ref|NP_001086583.1| (ribonuclease T2 [Xenopus laevis]) HSP 1 Score: 59.3 bits (142), Expect = 3.8e-06 Identity = 28/71 (39.44%), Postives = 42/71 (59.15%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|