CU094329 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTTTTTTTTAGTATAAAATCGATCAATTCATAAGCTAAAAAGTATCCTTAAAGTAAGGTTCCAAGGCGTGTAGTGCCTCTACATAATGCACAATAGAGGTTCAACACAAAGGGGTAAACAAGGAATTTTATACAGGATTAGCGAGCAGCAGCTACAACTTTTAATTGTTAACTAAGCGGAAATCTACTTCCCTTTCCATCTCCTCATGACGAAGTGTTCATGTTCTAACTACTCACCATTTTTGGCACTTTGTTGCATTCGTGACTCATAGAAGAGTCTCACAGTAGAGAAGATTAAGGAAGGTTCAGCCATTGCACCATTGCCATAGTCCCCACAAGCCAGCCTCTTCGTAACAGGTGGTATAAGAGTTATCCCAAGTTCATCGATTGCAATGAGATGCCGCTCAGTGAAAGGGTTGGTCCACATAAAGGTATTCATTGCAGGCGCAACAAAGAGTGGTTTGTTATAGTCCCATGCTCGCACAAC
BLAST of CU094329 vs. Swiss-Prot
Match: HAL3A_ARATH (Phosphopantothenoylcysteine decarboxylase OS=Arabidopsis thaliana GN=HAL3A PE=1 SV=1) HSP 1 Score: 145.2 bits (365), Expect = 6.2e-34 Identity = 64/79 (81.01%), Postives = 71/79 (89.87%), Query Frame = -1
BLAST of CU094329 vs. Swiss-Prot
Match: HAL3B_ARATH (Probable phosphopantothenoylcysteine decarboxylase OS=Arabidopsis thaliana GN=HAL3B PE=2 SV=2) HSP 1 Score: 143.3 bits (360), Expect = 2.4e-33 Identity = 63/79 (79.75%), Postives = 72/79 (91.14%), Query Frame = -1
BLAST of CU094329 vs. Swiss-Prot
Match: HAL3_ORYSJ (Phosphopantothenoylcysteine decarboxylase OS=Oryza sativa subsp. japonica GN=HAL3 PE=1 SV=1) HSP 1 Score: 128.3 bits (321), Expect = 7.9e-29 Identity = 58/71 (81.69%), Postives = 63/71 (88.73%), Query Frame = -1
BLAST of CU094329 vs. Swiss-Prot
Match: COAC_MOUSE (Phosphopantothenoylcysteine decarboxylase OS=Mus musculus GN=Ppcdc PE=1 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 4.6e-13 Identity = 39/82 (47.56%), Postives = 47/82 (57.32%), Query Frame = -1
BLAST of CU094329 vs. Swiss-Prot
Match: COAC_HUMAN (Phosphopantothenoylcysteine decarboxylase OS=Homo sapiens GN=PPCDC PE=1 SV=2) HSP 1 Score: 75.1 bits (183), Expect = 7.9e-13 Identity = 40/82 (48.78%), Postives = 46/82 (56.10%), Query Frame = -1
BLAST of CU094329 vs. TrEMBL
Match: A0A0A0LR29_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G050090 PE=4 SV=1) HSP 1 Score: 178.3 bits (451), Expect = 7.4e-42 Identity = 85/85 (100.00%), Postives = 85/85 (100.00%), Query Frame = -1
BLAST of CU094329 vs. TrEMBL
Match: E5GBX2_CUCME (Phosphopentothenoylcysteine decarboxylase OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 178.3 bits (451), Expect = 7.4e-42 Identity = 85/85 (100.00%), Postives = 85/85 (100.00%), Query Frame = -1
BLAST of CU094329 vs. TrEMBL
Match: W9RGR9_9ROSA (Phosphopantothenoylcysteine decarboxylase OS=Morus notabilis GN=L484_008185 PE=4 SV=1) HSP 1 Score: 153.3 bits (386), Expect = 2.5e-34 Identity = 70/83 (84.34%), Postives = 77/83 (92.77%), Query Frame = -1
BLAST of CU094329 vs. TrEMBL
Match: A0A0V0HMX8_SOLCH (Putative phosphopantothenoylcysteine decarboxylase-like OS=Solanum chacoense PE=4 SV=1) HSP 1 Score: 152.1 bits (383), Expect = 5.7e-34 Identity = 70/83 (84.34%), Postives = 75/83 (90.36%), Query Frame = -1
BLAST of CU094329 vs. TrEMBL
Match: C6SZ50_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_03G020900 PE=2 SV=1) HSP 1 Score: 152.1 bits (383), Expect = 5.7e-34 Identity = 71/85 (83.53%), Postives = 78/85 (91.76%), Query Frame = -1
BLAST of CU094329 vs. NCBI nr
Match: gi|449469602|ref|XP_004152508.1| (PREDICTED: probable phosphopantothenoylcysteine decarboxylase [Cucumis sativus]) HSP 1 Score: 181.8 bits (460), Expect = 9.6e-43 Identity = 85/85 (100.00%), Postives = 85/85 (100.00%), Query Frame = -1
BLAST of CU094329 vs. NCBI nr
Match: gi|703119739|ref|XP_010101940.1| (Phosphopantothenoylcysteine decarboxylase [Morus notabilis]) HSP 1 Score: 156.8 bits (395), Expect = 3.3e-35 Identity = 70/83 (84.34%), Postives = 77/83 (92.77%), Query Frame = -1
BLAST of CU094329 vs. NCBI nr
Match: gi|747046609|ref|XP_011100508.1| (PREDICTED: probable phosphopantothenoylcysteine decarboxylase [Sesamum indicum]) HSP 1 Score: 156.4 bits (394), Expect = 4.3e-35 Identity = 69/83 (83.13%), Postives = 78/83 (93.98%), Query Frame = -1
BLAST of CU094329 vs. NCBI nr
Match: gi|922334014|ref|XP_013444998.1| (phosphopantothenoylcysteine decarboxylase [Medicago truncatula]) HSP 1 Score: 155.6 bits (392), Expect = 7.3e-35 Identity = 71/85 (83.53%), Postives = 78/85 (91.76%), Query Frame = -1
BLAST of CU094329 vs. NCBI nr
Match: gi|460400179|ref|XP_004245613.1| (PREDICTED: phosphopantothenoylcysteine decarboxylase [Solanum lycopersicum]) HSP 1 Score: 155.6 bits (392), Expect = 7.3e-35 Identity = 70/83 (84.34%), Postives = 75/83 (90.36%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|