CU093671 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGTCATGAATCTCGTAATCCTTAAGAGTGATATGATCCTTATAGATATTATACCACTTCTGGATCCTGATTTTCTCAGTCCGGGTTCCGGTCTGAGCGGCGACAAGCTTCTTCAAGTCTCCAATCGTATCATCCTCGTTGCACTTCACACGGACCTTCTTGCCTAGACGATCGTTGAGCACGACCTCGATCATCCTCGCCCCCAATCGGAAATATTATGAACCGCAGGTGAAAGAGAGATTTTGTGGATGTCCCCGA
BLAST of CU093671 vs. Swiss-Prot
Match: UBL5_ARATH (Ubiquitin-like protein 5 OS=Arabidopsis thaliana GN=UBL5 PE=3 SV=1) HSP 1 Score: 131.0 bits (328), Expect = 6.4e-30 Identity = 62/64 (96.88%), Postives = 61/64 (95.31%), Query Frame = -2
BLAST of CU093671 vs. Swiss-Prot
Match: UBL5_CAEEL (Ubiquitin-like protein 5 OS=Caenorhabditis elegans GN=ubl-5 PE=3 SV=1) HSP 1 Score: 111.3 bits (277), Expect = 5.2e-24 Identity = 50/64 (78.12%), Postives = 55/64 (85.94%), Query Frame = -2
BLAST of CU093671 vs. Swiss-Prot
Match: UBL5_BOVIN (Ubiquitin-like protein 5 OS=Bos taurus GN=UBL5 PE=3 SV=1) HSP 1 Score: 110.9 bits (276), Expect = 6.8e-24 Identity = 51/64 (79.69%), Postives = 55/64 (85.94%), Query Frame = -2
BLAST of CU093671 vs. Swiss-Prot
Match: UBL5_PSAOB (Ubiquitin-like protein 5 OS=Psammomys obesus GN=UBL5 PE=3 SV=1) HSP 1 Score: 110.9 bits (276), Expect = 6.8e-24 Identity = 51/64 (79.69%), Postives = 55/64 (85.94%), Query Frame = -2
BLAST of CU093671 vs. Swiss-Prot
Match: UBL5_MOUSE (Ubiquitin-like protein 5 OS=Mus musculus GN=Ubl5 PE=1 SV=1) HSP 1 Score: 110.9 bits (276), Expect = 6.8e-24 Identity = 51/64 (79.69%), Postives = 55/64 (85.94%), Query Frame = -2
BLAST of CU093671 vs. TrEMBL
Match: A0A059ADC7_EUCGR (Uncharacterized protein (Fragment) OS=Eucalyptus grandis GN=EUGRSUZ_J00924 PE=4 SV=1) HSP 1 Score: 135.6 bits (340), Expect = 2.9e-29 Identity = 64/69 (92.75%), Postives = 67/69 (97.10%), Query Frame = -2
BLAST of CU093671 vs. TrEMBL
Match: A0A0A0LSS0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G126050 PE=4 SV=1) HSP 1 Score: 134.0 bits (336), Expect = 8.4e-29 Identity = 64/64 (100.00%), Postives = 64/64 (100.00%), Query Frame = -2
BLAST of CU093671 vs. TrEMBL
Match: A0A0N7KFQ6_ORYSJ (Os02g0628800 protein (Fragment) OS=Oryza sativa subsp. japonica GN=Os02g0628800 PE=4 SV=1) HSP 1 Score: 133.7 bits (335), Expect = 1.1e-28 Identity = 64/67 (95.52%), Postives = 64/67 (95.52%), Query Frame = -2
BLAST of CU093671 vs. TrEMBL
Match: A0A0D9YV97_9ORYZ (Uncharacterized protein OS=Oryza glumipatula PE=4 SV=1) HSP 1 Score: 133.7 bits (335), Expect = 1.1e-28 Identity = 64/67 (95.52%), Postives = 64/67 (95.52%), Query Frame = -2
BLAST of CU093671 vs. TrEMBL
Match: I1P2E6_ORYGL (Uncharacterized protein OS=Oryza glaberrima PE=4 SV=1) HSP 1 Score: 133.7 bits (335), Expect = 1.1e-28 Identity = 64/67 (95.52%), Postives = 64/67 (95.52%), Query Frame = -2
BLAST of CU093671 vs. NCBI nr
Match: gi|629085023|gb|KCW51380.1| (hypothetical protein EUGRSUZ_J00924, partial [Eucalyptus grandis]) HSP 1 Score: 135.2 bits (339), Expect = 5.4e-29 Identity = 64/69 (92.75%), Postives = 67/69 (97.10%), Query Frame = -2
BLAST of CU093671 vs. NCBI nr
Match: gi|449443353|ref|XP_004139444.1| (PREDICTED: ubiquitin-like protein 5 [Cucumis sativus]) HSP 1 Score: 133.7 bits (335), Expect = 1.6e-28 Identity = 64/64 (100.00%), Postives = 64/64 (100.00%), Query Frame = -2
BLAST of CU093671 vs. NCBI nr
Match: gi|937904827|dbj|BAS79881.1| (Os02g0628800, partial [Oryza sativa Japonica Group]) HSP 1 Score: 133.3 bits (334), Expect = 2.0e-28 Identity = 64/67 (95.52%), Postives = 64/67 (95.52%), Query Frame = -2
BLAST of CU093671 vs. NCBI nr
Match: gi|657952783|ref|XP_008359285.1| (PREDICTED: ubiquitin-like protein 5 [Malus domestica]) HSP 1 Score: 132.9 bits (333), Expect = 2.7e-28 Identity = 63/67 (94.03%), Postives = 65/67 (97.01%), Query Frame = -2
BLAST of CU093671 vs. NCBI nr
Match: gi|514805304|ref|XP_004977514.1| (PREDICTED: ubiquitin-like protein 5 [Setaria italica]) HSP 1 Score: 132.1 bits (331), Expect = 4.6e-28 Identity = 63/65 (96.92%), Postives = 64/65 (98.46%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|