CU093546 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATCAATCTGCGATGCCCAATGGAACAACTACTGAGAATGGAGGTTCAAATGCCACATTCCGTCATGCAAATCCGAGTGCTACAGAAGCTACTCCAAACAACATACTATTTATTGAGAATTTGCCCCCATGAAACCTCTAGTATGATGTTGCAAGTCCTCTTCCAACAATATCCTGGATTCAGGGAAGTCCGGATGATTGAAGCAAAGCCGGGTATTGCTTTCGTTGAGTTTGAAGATGATGTTCAATCCTCTATGGCTATGCAGGCTCTTCAAGGTCTTTAAAATTCGACCCCCAAC
BLAST of CU093546 vs. Swiss-Prot
Match: RU2B2_ARATH (U2 small nuclear ribonucleoprotein B'' 2 OS=Arabidopsis thaliana GN=At1g06960 PE=1 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 1.3e-18 Identity = 44/51 (86.27%), Postives = 48/51 (94.12%), Query Frame = 1
HSP 2 Score: 39.3 bits (90), Expect = 2.9e-02 Identity = 22/42 (52.38%), Postives = 24/42 (57.14%), Query Frame = 3
BLAST of CU093546 vs. Swiss-Prot
Match: RU2B1_ARATH (U2 small nuclear ribonucleoprotein B'' OS=Arabidopsis thaliana GN=U2B'' PE=1 SV=1) HSP 1 Score: 92.0 bits (227), Expect = 3.8e-18 Identity = 41/51 (80.39%), Postives = 48/51 (94.12%), Query Frame = 1
HSP 2 Score: 31.2 bits (69), Expect = 7.9e+00 Identity = 18/37 (48.65%), Postives = 20/37 (54.05%), Query Frame = 3
BLAST of CU093546 vs. Swiss-Prot
Match: RU2B_ORYSJ (U2 small nuclear ribonucleoprotein B'' OS=Oryza sativa subsp. japonica GN=Os03g0298800 PE=2 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 5.0e-18 Identity = 44/51 (86.27%), Postives = 46/51 (90.20%), Query Frame = 1
HSP 2 Score: 32.0 bits (71), Expect = 4.6e+00 Identity = 18/42 (42.86%), Postives = 19/42 (45.24%), Query Frame = 3
BLAST of CU093546 vs. Swiss-Prot
Match: RU2B_ORYSI (U2 small nuclear ribonucleoprotein B'' OS=Oryza sativa subsp. indica GN=OsI_11177 PE=3 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 5.0e-18 Identity = 44/51 (86.27%), Postives = 46/51 (90.20%), Query Frame = 1
HSP 2 Score: 32.0 bits (71), Expect = 4.6e+00 Identity = 18/42 (42.86%), Postives = 19/42 (45.24%), Query Frame = 3
BLAST of CU093546 vs. Swiss-Prot
Match: RU1A_ARATH (U1 small nuclear ribonucleoprotein A OS=Arabidopsis thaliana GN=U1A PE=1 SV=1) HSP 1 Score: 81.6 bits (200), Expect = 5.2e-15 Identity = 38/51 (74.51%), Postives = 44/51 (86.27%), Query Frame = 1
BLAST of CU093546 vs. TrEMBL
Match: A0A0A0LPT7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025950 PE=4 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 1.1e-19 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = 1
BLAST of CU093546 vs. TrEMBL
Match: A0A0A0LPT7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025950 PE=4 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 7.9e-15 Identity = 41/41 (100.00%), Postives = 41/41 (100.00%), Query Frame = 3
HSP 2 Score: 102.8 bits (255), Expect = 2.4e-19 Identity = 50/51 (98.04%), Postives = 51/51 (100.00%), Query Frame = 1
BLAST of CU093546 vs. TrEMBL
Match: U5FWN4_POPTR (Small nuclear ribonucleoprotein U2B OS=Populus trichocarpa GN=POPTR_0013s14980g PE=4 SV=1) HSP 1 Score: 47.0 bits (110), Expect = 1.5e-02 Identity = 24/42 (57.14%), Postives = 27/42 (64.29%), Query Frame = 3
HSP 2 Score: 102.8 bits (255), Expect = 2.4e-19 Identity = 50/51 (98.04%), Postives = 51/51 (100.00%), Query Frame = 1
BLAST of CU093546 vs. TrEMBL
Match: U5FTH6_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0013s14980g PE=4 SV=1) HSP 1 Score: 47.0 bits (110), Expect = 1.5e-02 Identity = 24/42 (57.14%), Postives = 27/42 (64.29%), Query Frame = 3
HSP 2 Score: 102.8 bits (255), Expect = 2.4e-19 Identity = 50/51 (98.04%), Postives = 51/51 (100.00%), Query Frame = 1
BLAST of CU093546 vs. TrEMBL
Match: B9INS5_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0019s14440g PE=4 SV=2) HSP 1 Score: 44.3 bits (103), Expect = 1.0e-01 Identity = 23/42 (54.76%), Postives = 26/42 (61.90%), Query Frame = 3
HSP 2 Score: 100.5 bits (249), Expect = 1.2e-18 Identity = 49/50 (98.00%), Postives = 50/50 (100.00%), Query Frame = 1
BLAST of CU093546 vs. NCBI nr
Match: gi|449439191|ref|XP_004137370.1| (PREDICTED: U2 small nuclear ribonucleoprotein B'' 2-like [Cucumis sativus]) HSP 1 Score: 105.1 bits (261), Expect = 6.9e-20 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = 1
BLAST of CU093546 vs. NCBI nr
Match: gi|659114937|ref|XP_008457301.1| (PREDICTED: U2 small nuclear ribonucleoprotein B'' 2-like [Cucumis melo]) HSP 1 Score: 105.1 bits (261), Expect = 6.9e-20 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = 1
BLAST of CU093546 vs. NCBI nr
Match: gi|743897119|ref|XP_011041843.1| (PREDICTED: U2 small nuclear ribonucleoprotein B'' 2-like [Populus euphratica]) HSP 1 Score: 104.0 bits (258), Expect = 1.5e-19 Identity = 50/51 (98.04%), Postives = 51/51 (100.00%), Query Frame = 1
BLAST of CU093546 vs. NCBI nr
Match: gi|566201401|ref|XP_006376548.1| (hypothetical protein POPTR_0013s14980g [Populus trichocarpa]) HSP 1 Score: 104.0 bits (258), Expect = 1.5e-19 Identity = 50/51 (98.04%), Postives = 51/51 (100.00%), Query Frame = 1
BLAST of CU093546 vs. NCBI nr
Match: gi|743819938|ref|XP_011021009.1| (PREDICTED: U2 small nuclear ribonucleoprotein B'' 2-like [Populus euphratica]) HSP 1 Score: 104.0 bits (258), Expect = 1.5e-19 Identity = 50/51 (98.04%), Postives = 51/51 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|