CU092557 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGGCTGAGATTTGAGGTTGCGGAGAACGAAGAATCCGGCAAGCGTCGCTGAGAGAAATATGAGAATAAACCTCAGCGGACACATAATTTTTTTTGTTCTTCTTCTACTTCTTTCTCTAACCTCTGGATCCCCACCATATTCTGTGTTACTCAGTTTTGTTGAGTTGAGCCAAAATTGCAGCAGGGACTTCATTGTATTTCCAAGTTGACTCTCATCTAGACTTTAGCAAACCGAGCGATTGTAGCCAAAACTGATCTTAAACTACGGATGCCAGCTCCTGATTTTGAACTAACCATCATCAGAGGTTGCACAATTGACTTGTTTCGCGTGAGTCTCTCTTCAATTTGCATTGCTCTAC
BLAST of CU092557 vs. TrEMBL
Match: A0A0A0LPR1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025170 PE=3 SV=1) HSP 1 Score: 86.7 bits (213), Expect = 2.1e-14 Identity = 46/46 (100.00%), Postives = 46/46 (100.00%), Query Frame = -3
BLAST of CU092557 vs. TrEMBL
Match: A0A151UA06_CAJCA (Putative GTP-binding protein engB OS=Cajanus cajan GN=KK1_020381 PE=3 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 1.9e-10 Identity = 37/45 (82.22%), Postives = 41/45 (91.11%), Query Frame = -3
BLAST of CU092557 vs. TrEMBL
Match: A0A067LBI2_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_17329 PE=3 SV=1) HSP 1 Score: 73.2 bits (178), Expect = 2.4e-10 Identity = 38/46 (82.61%), Postives = 42/46 (91.30%), Query Frame = -3
BLAST of CU092557 vs. TrEMBL
Match: A0A0D2MPA3_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_003G152200 PE=3 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 7.1e-10 Identity = 36/46 (78.26%), Postives = 42/46 (91.30%), Query Frame = -3
BLAST of CU092557 vs. TrEMBL
Match: A0A0D2RN49_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_003G152200 PE=3 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 7.1e-10 Identity = 36/46 (78.26%), Postives = 42/46 (91.30%), Query Frame = -3
BLAST of CU092557 vs. NCBI nr
Match: gi|449439155|ref|XP_004137353.1| (PREDICTED: uncharacterized protein LOC101223165 [Cucumis sativus]) HSP 1 Score: 84.7 bits (208), Expect = 1.2e-13 Identity = 46/46 (100.00%), Postives = 46/46 (100.00%), Query Frame = -3
BLAST of CU092557 vs. NCBI nr
Match: gi|659107010|ref|XP_008453496.1| (PREDICTED: uncharacterized protein LOC103494192 isoform X1 [Cucumis melo]) HSP 1 Score: 78.6 bits (192), Expect = 8.3e-12 Identity = 43/46 (93.48%), Postives = 44/46 (95.65%), Query Frame = -3
BLAST of CU092557 vs. NCBI nr
Match: gi|659107018|ref|XP_008453498.1| (PREDICTED: uncharacterized protein LOC103494192 isoform X2 [Cucumis melo]) HSP 1 Score: 78.6 bits (192), Expect = 8.3e-12 Identity = 43/46 (93.48%), Postives = 44/46 (95.65%), Query Frame = -3
BLAST of CU092557 vs. NCBI nr
Match: gi|729327003|ref|XP_010535339.1| (PREDICTED: uncharacterized protein LOC104810688 [Tarenaya hassleriana]) HSP 1 Score: 72.4 bits (176), Expect = 5.9e-10 Identity = 39/46 (84.78%), Postives = 42/46 (91.30%), Query Frame = -3
BLAST of CU092557 vs. NCBI nr
Match: gi|1012364973|gb|KYP76155.1| (putative GTP-binding protein engB [Cajanus cajan]) HSP 1 Score: 71.6 bits (174), Expect = 1.0e-09 Identity = 37/45 (82.22%), Postives = 41/45 (91.11%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|