CU091804 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTGCTATGCGATAAAATTGCTGTATAGCTTACAGTATCACTCAAGTTGTCAGATTTTCCTAGCTGCCCCGGAGATCCAACCAAGCATCCACATCCACCAAAAAAGTTTAGCCCTGTTTTCCTTTTTCTTCGGAGATGTACTCCATGATAACCGTGAAACTTTAGACCCCTTAATATGAGTCTATCCCCCTTTTCTATTTTAAAACTGTTTGTACTTGCTTCTACTAAGGGCCTAATAATGTCAACTTTATCATCAGCCATACCACTGAGTGAAGGAAACCCAATAGAGATTTAAGAAGATGAACGACGAAT
BLAST of CU091804 vs. TrEMBL
Match: A0A0A0KU85_CUCSA (7,8-dihydroneopterin aldolase OS=Cucumis sativus GN=Csa_4G026280 PE=3 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 6.4e-23 Identity = 63/82 (76.83%), Postives = 65/82 (79.27%), Query Frame = -1
BLAST of CU091804 vs. TrEMBL
Match: W1P9Z5_AMBTC (7,8-dihydroneopterin aldolase OS=Amborella trichopoda GN=AMTR_s00058p00214740 PE=3 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 2.4e-06 Identity = 31/62 (50.00%), Postives = 42/62 (67.74%), Query Frame = -1
BLAST of CU091804 vs. TrEMBL
Match: A0A068UQN4_COFCA (7,8-dihydroneopterin aldolase OS=Coffea canephora GN=GSCOC_T00031337001 PE=3 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 2.4e-06 Identity = 34/72 (47.22%), Postives = 43/72 (59.72%), Query Frame = -1
BLAST of CU091804 vs. TrEMBL
Match: A0A068V5J2_COFCA (7,8-dihydroneopterin aldolase OS=Coffea canephora GN=GSCOC_T00015853001 PE=3 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 2.4e-06 Identity = 34/72 (47.22%), Postives = 45/72 (62.50%), Query Frame = -1
BLAST of CU091804 vs. TrEMBL
Match: W1PGF8_AMBTC (7,8-dihydroneopterin aldolase OS=Amborella trichopoda GN=AMTR_s00058p00214360 PE=3 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 5.4e-06 Identity = 31/62 (50.00%), Postives = 41/62 (66.13%), Query Frame = -1
BLAST of CU091804 vs. NCBI nr
Match: gi|449458291|ref|XP_004146881.1| (PREDICTED: dihydroneopterin aldolase 2 [Cucumis sativus]) HSP 1 Score: 115.5 bits (288), Expect = 5.3e-23 Identity = 63/82 (76.83%), Postives = 65/82 (79.27%), Query Frame = -1
BLAST of CU091804 vs. NCBI nr
Match: gi|659111322|ref|XP_008455695.1| (PREDICTED: dihydroneopterin aldolase-like [Cucumis melo]) HSP 1 Score: 109.8 bits (273), Expect = 2.9e-21 Identity = 60/82 (73.17%), Postives = 64/82 (78.05%), Query Frame = -1
BLAST of CU091804 vs. NCBI nr
Match: gi|661880556|emb|CDP15774.1| (unnamed protein product [Coffea canephora]) HSP 1 Score: 60.1 bits (144), Expect = 2.7e-06 Identity = 34/72 (47.22%), Postives = 45/72 (62.50%), Query Frame = -1
BLAST of CU091804 vs. NCBI nr
Match: gi|661885957|emb|CDP10574.1| (unnamed protein product [Coffea canephora]) HSP 1 Score: 60.1 bits (144), Expect = 2.7e-06 Identity = 34/72 (47.22%), Postives = 43/72 (59.72%), Query Frame = -1
BLAST of CU091804 vs. NCBI nr
Match: gi|586701506|ref|XP_006845027.1| (PREDICTED: dihydroneopterin aldolase 2 [Amborella trichopoda]) HSP 1 Score: 59.7 bits (143), Expect = 3.5e-06 Identity = 31/62 (50.00%), Postives = 42/62 (67.74%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|